ITIH3 (NM_002217) Human 3' UTR Clone

CAT#: SC204360

3' UTR clone of inter-alpha (globulin) inhibitor H3 (ITIH3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ITIH3 (NM_002217) Human 3' UTR Clone
Vector pMirTarget
Synonyms H3P; ITI-HC3; SHAP
ACCN NM_002217
Insert Size 146 bp
Sequence Data
>SC204360 3’UTR clone of NM_002217
The sequence shown below is from the reference sequence of NM_002217. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGACTACATTGTCCCCAACCTGTTTTGAGTAGACACACCAGCTCCTGTTGGGATGGATGGCCCGGAT
TTTATGGCATCTGGAACATGGGCACAGAGAGGGGCCTGTGGGAGGGGCTGGGAAAATAAAGTCCAAGGT
CGAGACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002217.4
Synonyms H3P; ITI-HC3; SHAP
Summary This gene encodes the heavy chain subunit of the pre-alpha-trypsin inhibitor complex. This complex may stabilize the extracellular matrix through its ability to bind hyaluronic acid. Polymorphisms of this gene may be associated with increased risk for schizophrenia and major depressive disorder. This gene is present in an inter-alpha-trypsin inhibitor family gene cluster on chromosome 3. [provided by RefSeq, Jul 2015]
Locus ID 3699
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...