KCNF1 (NM_002236) Human 3' UTR Clone

CAT#: SC204369

3' UTR clone of potassium voltage-gated channel subfamily F member 1 (KCNF1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KCNF1 (NM_002236) Human 3' UTR Clone
Vector pMirTarget
Synonyms IK8; KCNF; kH1; KV5.1
ACCN NM_002236
Insert Size 344 bp
Sequence Data
>SC204369 3’UTR clone of NM_002236
The sequence shown below is from the reference sequence of NM_002236. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACAGGACCCGGCTCCAGAGTTGCAAGTGACAGGAGGGCCCCTCAGGCAGAGATGGACCAGGCGGTGGA
CAGATGGGTAGATGTGGCAGGCATGTCATCGACAGCACAGAAGGGCTGTCCTGTGTCCCCCCAACCCTC
CCCTGGACAGACTCTGAAGGCCCTCCCGGCACCTCTGCCAAGGCTGGGTAAGACTCCTCTATGTTGCCT
GCTGTCCAGGAGCCCGGGAGGGAGGGGTGTGCAGGAGCCGCAGGGCCGTGTGGGACGAGTGGAGGCCGC
GGCCTGGCTGGCACGAGAGCCCACGCCCGCTTCTGTATCTCCCTCAATAAAGCCTCCTGCTCTGTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002236.5
Synonyms IK8; KCNF; kH1; KV5.1
Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily F. This gene is intronless and expressed in all tissues tested, including the heart, skeletal muscle, brain, kidney, and pancreas. [provided by RefSeq, Jul 2008]
Locus ID 3754
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...