Nectin 2 (NECTIN2) (NM_002856) Human 3' UTR Clone

CAT#: SC204469

3' UTR clone of poliovirus receptor-related 2 (herpesvirus entry mediator B) (PVRL2) transcript variant alpha for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Nectin 2 (NECTIN2) (NM_002856) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD112; HVEB; PRR2; PVRL2; PVRR2
ACCN NM_002856
Insert Size 348 bp
Sequence Data
>SC204469 3’UTR clone of NM_002856
The sequence shown below is from the reference sequence of NM_002856. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCATCTCACGGCGGGCAGTTTATGTGTGACCTGGACACAGACAGAGACAGAGCCAGGCCCGGCCCTCC
CGCCCCCGACCTGACCACGCCGGCCTAGGGTTCCAGACTGGTTGGACTTGTTCGTCTGGACGACACTGG
AGTGGAACACTGCCTCCCACTTTCTTGGGACTTGGAGGGAGGTGGAACAGCACACTGGACTTCTCCCGT
CTCTAGGGCTGCATGGGGAGCCCGGGGAGCTGAGTAGTGGGGATCCAGAGAGGACCCCCGCCCCCAGAG
ACTTGGTTTTGGCTCCAGCCTTCCCCTGGCCCCGTGACACTCAGGAGTTAATAAATGCCTTGGAGGAAA
ACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002856.3
Synonyms CD112; HVEB; PRR2; PVRL2; PVRR2
Summary This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 5819
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...