HYAL2 (NM_003773) Human 3' UTR Clone

CAT#: SC204528

3' UTR clone of hyaluronoglucosaminidase 2 (HYAL2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HYAL2 (NM_003773) Human 3' UTR Clone
Vector pMirTarget
Synonyms LUCA2
ACCN NM_003773
Insert Size 351 bp
Sequence Data
>SC204528 3’UTR clone of NM_003773
The sequence shown below is from the reference sequence of NM_003773. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAGCCCTGGCCTTTACCTGGACCTTGTAGGGGTCTCCTGCCTAGCTGCCTAGCAAGCTGGCCTCTACC
ACAAGGGCTCTCTTAGGCATGTAGGACCCTGCAGGGGGTGGACAAACTGGAGTCTGGAGTGGGCAGAGC
CCCCAGGAAGCCCAGGAGGGCATCCATACCAGCTCGCACCCCCCTGTTCTAAGGGGGAGGGGAAGTCCC
TGGGAGGCCCCTTCTCTCCCTGCCAGAGGGGAAGGAGGGTACAGCTGGGCTGGGGAGGACCTGACCCTA
CTCCCTTGCCCTAGATAGTTTATTATTATTATTATTTTGGGGTCTCTTTTGTAAATTAAACATAAAACA
ATTGCT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003773.5
Synonyms LUCA2
Summary This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
Locus ID 8692
MW 12.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...