ATP1A4 (NM_144699) Human 3' UTR Clone

CAT#: SC204585

3' UTR clone of ATPase Na+/K+ transporting alpha 4 polypeptide (ATP1A4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP1A4 (NM_144699) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP1A1; ATP1AL2
ACCN NM_144699
Insert Size 311 bp
Sequence Data
>SC204585 3’UTR clone of NM_144699
The sequence shown below is from the reference sequence of NM_144699. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCTGGGTGGAAAGGGAGACGTACTACTAAACTCAGCAGATGAAGAGCTTCATGTGACACAGGGGTGTT
GTGAGAGCTGGGATGGGGCCAGAGATTATAAGTTTGACACAACATCTGAGACACTAGGATGAATTATCT
TGGATGAGAAAGATGGGCAATCCTGGGCTGGCTTGAGGGAATCATGGGCAGAGGATGAGGTGGGCTGAA
GGGAAGCCCAGCCTGCATCTAGCTGGAGCCCCGCAGGGAGGGGCATGGTCCTGCTGAATCCCGTAGCCA
GTCTAGACAGTAAATGTCTGGAAAAGCCCTCACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_144699.4
Synonyms ATP1A1; ATP1AL2
Summary The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 480
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...