Non Neuronal Enolase (ENO1) (NM_001428) Human 3' UTR Clone

CAT#: SC204788

3' UTR clone of enolase 1 (alpha) (ENO1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Non Neuronal Enolase (ENO1) (NM_001428) Human 3' UTR Clone
Vector pMirTarget
Synonyms ENO1L1; HEL-S-17; MPB1; NNE; PPH
ACCN NM_001428
Insert Size 390 bp
Sequence Data
>SC204788 3’UTR clone of NM_001428
The sequence shown below is from the reference sequence of NM_001428. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAACTTCAGAAACCCCTTGGCCAAGTAAGCTGTGGGCAGGCAAGCCCTTCGGTCACCTGTTGGCTAC
ACAGACCCCTCCCCTCGTGTCAGCTCAGGCAGCTCGAGGCCCCCGACCAACACTTGCAGGGGTCCCTGC
TAGTTAGCGCCCCACCGCCGTGGAGTTCGTACCGCTTCCTTAGAACTTCTACAGAAGCCAAGCTCCCTG
GAGCCCTGTTGGCAGCTCTAGCTTTGCAGTCGTGTAATTGGCCCAAGTCATTGTTTTTCTCGCCTCACT
TTCCACCAAGTGTCTAGAGTCATGTGAGCCTCGTGTCATCTCCGGGGTGGCCACAGGCTAGATCCCCGG
TGGTTTTGTGCTCAAAATAAAAAGCCTCAGTGACCCATGAGAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001428.5
Synonyms ENO1L1; HEL-S-17; MPB1; NNE; PPH
Summary This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]
Locus ID 2023
MW 14.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...