KRT81 (NM_002281) Human 3' UTR Clone

CAT#: SC204802

3' UTR clone of keratin 81 (KRT81) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KRT81 (NM_002281) Human 3' UTR Clone
Vector pMirTarget
Synonyms ghHkb1; Hb-1; HB1; hHAKB2-1; K81; KRTHB1; MLN137
ACCN NM_002281
Insert Size 372 bp
Sequence Data
>SC204802 3’UTR clone of NM_002281
The sequence shown below is from the reference sequence of NM_002281. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTGCGGCAGCAGCTGCCGGAAATGTTAGGCACCCCAACTCAAGTCCCAGGCCCCAGGCATCTTTCCT
GCCCTGCCTTGCTTGGCCCATCCAGTCCAGGCGCCTGGAGCAAGTGCTCAGCTACTTCTCCTGCACTTT
GAAAGACCCCTCCCACTCCTGGCCTCACATTTCTCTGTGTGATCCCCCACTTCTGGGCTCTGCCACCCC
ACAGTGGGAAAGGCCACCCTAGAAAGAAGTCCGCTGGCACCCATAGGAAGGGGCCTCAGGAGCAGGAAG
GGCCAGGACCAGAACCTTGCCCACGGCAACTGCCTTCCTGCCTCTCCCCTTCCTCCTCTGCTCTTGATC
TGTGTTTCAATAAATTAATGTAGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002281.4
Synonyms ghHkb1; Hb-1; HB1; hHAKB2-1; K81; KRTHB1; MLN137
Summary The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]
Locus ID 3887
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...