PPAP2C (PLPP2) (NM_003712) Human 3' UTR Clone

CAT#: SC204858

3' UTR clone of phosphatidic acid phosphatase type 2C (PPAP2C) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PPAP2C (PLPP2) (NM_003712) Human 3' UTR Clone
Vector pMirTarget
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
ACCN NM_003712
Insert Size 375 bp
Sequence Data
>SC204858 3’UTR clone of NM_003712
The sequence shown below is from the reference sequence of NM_003712. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACTATGGATACCCGCACTCCTCCTCCTGAGGCCGGACCCCGCCCAGGCAGGGAGCTGCTGTGAGTCCA
GCTGAGGCCCACCCAGGTGGTCCCTCCAGCCCTGGTTAGGCACTGAGGGCTCTGGACGGGCTCCAGGAA
CCCTGGGCTGATGGGAGCAGTGAGCGGGCTCCGCTGCCCCCTGCCCTGCACTGGACCAGGAGTCTGGAG
ATGCCTGGGTAGCCCTCAGCATTTGGAGGGGAACCTGTTCCCGTCGGTCCCCAAATATCCCCTTCTTTT
TATGGGGTTAAGGAAGGGACCGAGAGATCAGATAGTTGCTGTTTTGTAAAATGTAATGTATATGTGGTT
TTTAGTAAAATAGGGCACCTGTTTCACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003712.4
Synonyms LPP2; PAP-2c; PAP2-g; PPAP2C
Summary The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 8612
MW 13.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...