KIRREL 3 (KIRREL3) (NM_001161707) Human 3' UTR Clone

CAT#: SC205013

3' UTR clone of kin of IRRE like 3 (Drosophila) (KIRREL3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KIRREL 3 (KIRREL3) (NM_001161707) Human 3' UTR Clone
Vector pMirTarget
Synonyms KIRRE; MRD4; NEPH2; PRO4502
ACCN NM_001161707
Insert Size 402 bp
Sequence Data
>SC205013 3’UTR clone of NM_001161707
The sequence shown below is from the reference sequence of NM_001161707. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCAGGAGTGCAATGAACAGGGGTCCTAACAGTGCTGTGAGCTCCTGGGGCAGGGAGTGGGTCTGATG
CATCGGTGTATGTGAGCCTGGGCAACATGGCGCCTGGCAGAGTGGGCGCTAGGCTGAGGTTGACCTGGA
CTAGACTGAACTTCATCTGCAGGGCAGCCAGCATTTTGGATTGAACACATAGCTCTTTCAGTCAGGAAC
TGTACAGAAAGATAGGGGGAAAAGCGGTTTGTGGTTTGATCCTTGCTCTACAAGAGCTGTTAGTCTAGA
GAGACCCCATCTCTACAACAAAATAAAAATAAAGAGCTGCTAGTCTCACCAGAAAAGCAGGTCACTCAC
ACAGCTGTGGGGGAGTGGGTGGGGAAGCAATAAAGGAATTGCTTTGAGAAAACTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161707.1
Synonyms KIRRE; MRD4; NEPH2; PRO4502
Summary The protein encoded by this gene is a member of the nephrin-like protein family. These proteins are expressed in fetal and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of these proteins interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. The protein encoded by this gene is a synaptic cell adhesion molecule with multiple extracellular immunoglobulin-like domains and a cytoplasmic PDZ domain-binding motif. Mutations in this gene are associated with several neurological and cognitive disorders. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]
Locus ID 84623
MW 15
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...