FGF18 (NM_003862) Human 3' UTR Clone

CAT#: SC205170

3' UTR clone of fibroblast growth factor 18 (FGF18) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name FGF18 (NM_003862) Human 3' UTR Clone
Vector pMirTarget
Synonyms FGF-18; ZFGF5
ACCN NM_003862
Insert Size 395 bp
Sequence Data
>SC205170 3' UTR clone of NM_003862
The sequence shown below is from the reference sequence of NM_003862. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAAGAGGTCCCGTCGGATCCGGCCCACACACCCTGCCTAGGCCACCCCGCCGCGGCCCCTCAGGTCGCCC
TGGCCACACTCACACTCCCAGAAAACTGCATCAGAGGAATATTTTTACATGAAAAATAAGGAAGAAGCTC
TATTTTTGTACATTGTGTTTAAAAGAAGACAAAAACTGAACCAAAACTCTTGGGGGGAGGGGTGATAAGG
ATTTTATTGTTGACTTGAAACCCCCGATGACAAAAGACTCACGCAAAGGGACTGTAGTCAACCCACAGGT
GCTTGTCTCTCTCTAGGAACAGACAACTCTAAACTCGTCCCCAGAGGAGGACTTGAATGAGGAAACCAAC
ACTTTGAGAAACCAAAGTCCTTTTTCCCAAAGGTTCTGAAAGGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003862.1
Synonyms FGF-18; ZFGF5
Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]
Locus ID 8817
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...