SNRPF (NM_003095) Human 3' UTR Clone

CAT#: SC205399

3' UTR clone of small nuclear ribonucleoprotein polypeptide F (SNRPF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SNRPF (NM_003095) Human 3' UTR Clone
Vector pMirTarget
Synonyms Sm-F; SMF; snRNP-F
ACCN NM_003095
Insert Size 99 bp
Sequence Data
>SC205399 3’UTR clone of NM_003095
The sequence shown below is from the reference sequence of NM_003095. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAAGAAGATGGGGAAATGAGAGAATAGCATCTTTTGTGGGGGATTTTTTTTATATATATTTCTAGA
CAATAAAGATTTGTTTGTTTTTCAACTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003095.5
Synonyms Sm-F; SMF; snRNP-F
Summary Plays role in pre-mRNA splicing as core component of the SMN-Sm complex that mediates spliceosomal snRNP assembly and as component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome (PubMed:11991638, PubMed:18984161, PubMed:19325628, PubMed:23333303, PubMed:25555158, PubMed:26912367, PubMed:28502770, PubMed:28781166, PubMed:28076346). Component of both the pre-catalytic spliceosome B complex and activated spliceosome C complexes (PubMed:11991638, PubMed:28502770, PubMed:28781166, PubMed:28076346). Is also a component of the minor U12 spliceosome (PubMed:15146077). As part of the U7 snRNP it is involved in histone 3'-end processing (PubMed:12975319).[UniProtKB/Swiss-Prot Function]
Locus ID 6636
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...