C13orf15 (RGCC) (NM_014059) Human 3' UTR Clone

CAT#: SC205509

3' UTR clone of chromosome 13 open reading frame 15 (C13orf15) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C13orf15 (RGCC) (NM_014059) Human 3' UTR Clone
Vector pMirTarget
Synonyms bA157L14.2; C13orf15; RGC-32; RGC32
ACCN NM_014059
Insert Size 416 bp
Sequence Data
>SC205509 3’UTR clone of NM_014059
The sequence shown below is from the reference sequence of NM_014059. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATCTTGACAAAACTTTAGCAAGTATGTGAAACAAGAAGTTCTGGGTCCTTTCATCATAAGGGAGAAGC
TTCAGAAAGTTCCGAGGACCTGCTAAAATCAGCTACTAGAATCTGCTGCCAGAGGGGACAAAGACGTGC
ACTCAACCTTCTACCAGGCCACTCTCAGGCTCACCTTAAAATCAGCCCTTGATCCCATTTCTGGGCAAT
TTAGACAGTGAAACTGACTTTGTTTACCTGCTTGCAGCATATTAGAACAGACGATCCATGCTAATATTG
TATTTTCTCTTAAAACATAGCTTTCCTGTAATTTAAAGTGCTTTTATGAAAATATTTGTAATTAATTAT
ATATAGTTGGAAATAGCAGTAAGCTTTCCCATTATAATATATTTTTGTATACAAATAAAATTTGAACTG
AA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014059.3
Synonyms bA157L14.2; C13orf15; RGC-32; RGC32
Summary This gene is thought to regulate cell cycle progression. It is induced by p53 in response to DNA damage, or by sublytic levels of complement system proteins that result in activation of the cell cycle. The encoded protein localizes to the cytoplasm during interphase and to centrosomes during mitosis. The protein forms a complex with polo-like kinase 1. The protein also translocates to the nucleus in response to treatment with complement system proteins, and can associate with and increase the kinase activity of cell division cycle 2 protein. In different assays and cell types, overexpression of this protein has been shown to activate or suppress cell cycle progression. [provided by RefSeq, Jul 2008]
Locus ID 28984
MW 15.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...