MHF1 (CENPS) (NM_199294) Human 3' UTR Clone

CAT#: SC205616

3' UTR clone of apoptosis-inducing TAF9-like domain 1 (APITD1) transcript variant A for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MHF1 (CENPS) (NM_199294) Human 3' UTR Clone
Vector pMirTarget
Synonyms APITD1; CENP-S; FAAP16; MHF1
ACCN NM_199294
Insert Size 423 bp
Sequence Data
>SC205616 3' UTR clone of NM_199294
The sequence shown below is from the reference sequence of NM_199294. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCAAGGCAGCCAGCAGAGGCTGGAGTGGTGGAAAGTGAGAATTAAAGTCCCTCGCCGCTTGGAAAGTGC
AGCCTTCTACAGGTAGAGCCACCTAGAAATGCATATGGCTGCAAAGGAAACTTTGAAGGGTTAAATAGAG
ATTTAAAAAAATAAAATAAAAAGGCTGGGCTAGGGTGCTTTTTGTGCTGAATTCTCCACATTGTTAACTG
CCAAAGCTAGTTTTAGAGAATGAGAAAGTCTTAAGCAAAATACTCCCAGGTCTCACTCCAGAACATAAAA
ATGGTGTGTGATCAAATGGTATATATTAGAAATTACATCTGTTGTAATTAAAATTGTGTGAGCAATTAAA
CATGGTTGACTTTTTCAAGCAAAAATCAGTTCATCTTTTGATGTAATTTTCTAGGCTAAATGGCAATCTC
TGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_199294.1
Synonyms APITD1; CENP-S; FAAP16; MHF1
Summary This gene was identified in the neuroblastoma tumor suppressor candidate region on chromosome 1p36. It contains a TFIID-31 domain, similar to that found in TATA box-binding protein-associated factor, TAF(II)31, which is required for p53-mediated transcription activation. This gene was expressed at very low levels in neuroblastoma tumors, and was shown to reduce cell growth in neuroblastoma cells, suggesting that it may have a role in a cell death pathway. The protein is a component of multiple complexes, including the Fanconi anemia (FA) core complex, the APITD1/CENPS complex, and the CENPA-CAD (nucleosome distal) complex. Known functions include an involvement with chromatin associations of the FA core complex, and a role in the stable assembly of the outer kinetochore. Alternative splicing of this gene results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream cortistatin (CORT) gene, as represented in GeneID:100526739. An APITD1-related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2010]
Locus ID 378708
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...