NRIP (DCAF6) (NM_018442) Human 3' UTR Clone

CAT#: SC205634

3' UTR clone of DDB1 and CUL4 associated factor 6 (DCAF6) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NRIP (DCAF6) (NM_018442) Human 3' UTR Clone
Vector pMirTarget
Synonyms 1200006M05Rik; ARCAP; IQWD1; MSTP055; NRIP; PC326
ACCN NM_018442
Insert Size 450 bp
Sequence Data
>SC205634 3' UTR clone of NM_018442
The sequence shown below is from the reference sequence of NM_018442. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAGAAGGCTCTGGTCAAGAGAATGAAAATGAGGATGAGGAATAATAAACTCTTTTTGGCAAGCACTTAA
ATGTTCTGAAATTTGTATAAGACATTTATTATATTTTTTTCTTTACAGAGCTTTAGTGCAATTTTAAGGT
TATGGTTTTTGGAGTTTTTCCCTTTTTTTGGGATAACCTAACATTGGTTTGGAATGATTGTGTGCATGAA
TTTGGGAGATTGTATAAAACAAAACTAGCAGAATGTTTTTAAAACTTTTTGCCGTGTATGAGGAGTGCTA
GAAAATGCAAAGTGCAATATTTTCCCTAACCTTCAAATGTGGGAGCTTGGATCAATGTTGAAGAATAATT
TTCATCATAGTGAAAATGTTGGTTCAAATAAATTTCTACACTTGCCATTTGCATGTTTGTTGCTTTCTAA
TTAAAGAAACTGGTTGTTTTAAGATACCCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018442.2
Synonyms 1200006M05Rik; ARCAP; IQWD1; MSTP055; NRIP; PC326
Summary The protein encoded by this gene is a ligand-dependent coactivator of nuclear receptors, including nuclear receptor subfamily 3 group C member 1 (NR3C1), glucocorticoid receptor (GR), and androgen receptor (AR). The encoded protein and DNA damage binding protein 2 (DDB2) may act as tumor promoters and tumor suppressors, respectively, by regulating the level of androgen receptor in prostate tissues. In addition, this protein can act with glucocorticoid receptor to promote human papillomavirus gene expression. [provided by RefSeq, Mar 2017]
Locus ID 55827
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...