NFAT4 (NFATC3) (NM_173164) Human 3' UTR Clone

CAT#: SC205676

3' UTR clone of nuclear factor of activated T-cells cytoplasmic calcineurin-dependent 3 (NFATC3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NFAT4 (NFATC3) (NM_173164) Human 3' UTR Clone
Vector pMirTarget
Synonyms NFAT4; NFATX; nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3; nuclear factor of activated T-cells, cytoplasmic 3; nuclear factor of activated T-cells c3 isoform IE-Xa; T cell transcription factor NFAT4
ACCN NM_173164
Insert Size 451 bp
Sequence Data
>SC205676 3’UTR clone of NM_173164
The sequence shown below is from the reference sequence of NM_173164. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGTTCATCTCTGATATGTTCTTGAAGTAGTGAAGATTCAGGGACTTTATTCTCCCAAGTGTCATGAAA
AAGTTTCTATGGATTGCTTATTGGCATATGGTTGGGCTTTTAAATAAGTTGTTATTAGAAATATATGTT
AATATATAACTTTGCCAGGTACCACGGCTCACGCCTGTATCCCAGCACTTTGGAAGGCTGAGGCGGGTG
GATCACAAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGTAACGCTGTCTCTACTAAAAATACA
AAAAATTAGCCAGGCATGGTGGTGTGTGACTATAATCCCAGCTACTCGGGAGGCTGAGACAGGAGAATC
ACTTGAACCCGGGAGGTGGCAGTTGCAGGGAGCTAAGATCGCGCCATTGCACTCCAGCCTGGGCGGCAG
AGCAAGACTCCGTCTCGGGAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_173164.1
Synonyms NFAT4; NFATX; nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3; nuclear factor of activated T-cells, cytoplasmic 3; nuclear factor of activated T-cells c3 isoform IE-Xa; T cell transcription factor NFAT4
Summary The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
Locus ID 4775
MW 17.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...