CCL3L3 (NM_001001437) Human 3' UTR Clone

CAT#: SC205712

3' UTR clone of chemokine (C-C motif) ligand 3-like 3 (CCL3L3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CCL3L3 (NM_001001437) Human 3' UTR Clone
Vector pMirTarget
Synonyms 464.2; D17S1718; G0S19-2; LD78; LD78BETA; SCYA3L; SCYA3L1
ACCN NM_001001437
Insert Size 447 bp
Sequence Data
>SC205712 3’UTR clone of NM_001001437
The sequence shown below is from the reference sequence of NM_001001437. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACGTCAGTGACCTGGAGCTGAGTGCCTGAGGGGTCCAGAAGCTTCGAGGCCCAGCGACCTCAGTGGGC
CCAGTGGGGAGGAGCAGGAGCCTGAGCCTTGGGAACATGCGTGTGACCTCCACAGCTACCTCTTCTATG
GACTGGTTATTGCCAAACAGCCACACTGTGGGACTCTTCTTAACTTAAATTTTAATTTATTTATACTAT
TTAGTTTTTATAATTTATTTTTGATTTCACAGTGTGTTTGTGATTGTTTGCTCTGAGAGTTCCCCCTGT
CCCCTCCACCTTCCCTCACAGTGTGTCTGGTGACAACCGAGTGGCTGTCATCGGCCTGTGTAGGCAGTC
ATGGCACCAAAGCCACCAGACTGACAAATGTGTATCAGATGCTTTTGTTCAGGGCTGTGATCGGCCTGG
GGAAATAATAAAGATGTTCTTTTAAACGGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001437.4
Synonyms 464.2; D17S1718; G0S19-2; LD78; LD78BETA; SCYA3L; SCYA3L1
Summary This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility.[provided by RefSeq, Apr 2014]
Locus ID 414062
MW 16.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...