LAMA3 (NM_001127718) Human 3' UTR Clone

CAT#: SC205717

3' UTR clone of laminin alpha 3 (LAMA3) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name LAMA3 (NM_001127718) Human 3' UTR Clone
Vector pMirTarget
Synonyms BM600; E170; LAMNA; LOCS
ACCN NM_001127718
Insert Size 448 bp
Sequence Data
>SC205717 3’UTR clone of NM_001127718
The sequence shown below is from the reference sequence of NM_001127718. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCAGTCTGAATGGTTGTCCTGACCAGTAACCCAAGCCTATTTCACAGCAAGGAAATTCACCTTCAAAA
GCACTGATTACCCAATGCACCTCCCTCCCCAGCTCGAGATCATTCTTCACTCAGGACACAAACCAGACA
GGTTTAATAGCGAATCTAATTTTGAATTCTGACCATGGATACCCATCACTTTGGCATTCAGTGCTACAT
GTGTATTTTATATAAAAATCCCATTTCTTGAAGATAAAAAAATTGTTATTCAAATTGTTATGCACAGAA
TGTTTTTGGTAATATTAATTTCCACTAAAAAATTAAATGTCTTTTAAGAAACATTCTTTTCCACTTGTT
AAAAAAATTAAATATATTTTAAAGCACTTTAAGAATATGAAACTTTCATATATGTTAAAGGATTATAAT
TTATGGAATTAAAAAATGCAGTGTAGTCCTTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127718.4
Synonyms BM600; E170; LAMNA; LOCS
Summary The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
Locus ID 3909
MW 17.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...