Claudin 3 (CLDN3) (NM_001306) Human 3' UTR Clone

CAT#: SC205857

3' UTR clone of claudin 3 (CLDN3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Claudin 3 (CLDN3) (NM_001306) Human 3' UTR Clone
Vector pMirTarget
Synonyms C7orf1; CPE-R2; CPETR2; HRVP1; RVP1
ACCN NM_001306
Insert Size 420 bp
Sequence Data
>SC205857 3’UTR clone of NM_001306
The sequence shown below is from the reference sequence of NM_001306. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAGGCTACGACCGCAAGGACTACGTCTAAGGGACAGACGCAGGGAGACCCCACCACCACCACCACCAC
CAACACCACCACCACCACCGCGAGCTGGAGCGCGCACCAGGCCATCCAGCGTGCAGCCTTGCCTCGGAG
GCCAGCCCACCCCCAGAAGCCAGGAAGCCCCCGCGCTGGACTGGGGCAGCTTCCCCAGCAGCCACGGCT
TTGCGGGCCGGGCAGTCGACTTCGGGGCCCAGGGACCAACCTGCATGGACTGTGAAACCTCACCCTTCT
GGAGCACGGGGCCTGGGTGACCGCCAATACTTGACCACCCCGTCGAGCCCCATCGGGCCGCTGCCCCCA
TGCTCGCGCTGGGCAGGGACCGGCAGCCCTGGAAGGGGCACTTGATATTTTTCAATAAAAGCCTTTCGT
TTTGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001306.4
Synonyms C7orf1; CPE-R2; CPETR2; HRVP1; RVP1
Summary Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this intronless gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. It is also a low-affinity receptor for Clostridium perfringens enterotoxin, and shares aa sequence similarity with a putative apoptosis-related protein found in rat. [provided by RefSeq, Jul 2008]
Locus ID 1365
MW 15.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...