Nephronophthisis (NPHP1) (NM_000272) Human 3' UTR Clone

CAT#: SC206229

3' UTR clone of nephronophthisis 1 (juvenile) (NPHP1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Nephronophthisis (NPHP1) (NM_000272) Human 3' UTR Clone
Vector pMirTarget
Synonyms JBTS4; NPH1; SLSN1
ACCN NM_000272
Insert Size 473 bp
Sequence Data
>SC206229 3’UTR clone of NM_000272
The sequence shown below is from the reference sequence of NM_000272. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTGGGTGAAATGAGAAAGAATGCAGTGTGACAGTGGCAGCCTCTAGCCCTCAGCTTCCCACGGAATCAG
ATGGATCCTCCACGATTACGTGAATAAAATGATGGAACCAAAAATCACTGTCACTTTACAACTTAGGTT
TTACTCTTTTCTTTCTACAGACCATATTTTTAAAGAAATGTTTATACAATAATTTAAATATTTTTTAAA
ACCATAAAATAAATTTTTATAAGGAATACTGTTATATCTAAATTTAAACAGTATTTATTTTTTCAAAAA
CAGCTACTTAAGTTAATGGTATAGATTTCTATAAAAGCAAGATTTTGTCAAAAACTAAATTTATGATTA
TTCAAGAAAGTGAAAAAAACAACCTACAGAATGGGAAAACATATTTGCAAATCATCTAACTGATAAAGG
TCTAGTATCCAAAATATTTAAATTTATGAGTGTTAATAAAATTTATCTTGTTCAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000272.5
Synonyms JBTS4; NPH1; SLSN1
Summary This gene encodes a protein with src homology domain 3 (SH3) patterns. This protein interacts with Crk-associated substrate, and it appears to function in the control of cell division, as well as in cell-cell and cell-matrix adhesion signaling, likely as part of a multifunctional complex localized in actin- and microtubule-based structures. Mutations in this gene cause familial juvenile nephronophthisis type 1, a kidney disorder involving both tubules and glomeruli. Defects in this gene are also associated with Senior-Loken syndrome type 1, also referred to as juvenile nephronophthisis with Leber amaurosis, which is characterized by kidney and eye disease, and with Joubert syndrome type 4, which is characterized by cerebellar ataxia, oculomotor apraxia, psychomotor delay and neonatal breathing abnormalities, sometimes including retinal dystrophy and renal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 4867
MW 18.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...