KF1 (RNF103) (NM_005667) Human 3' UTR Clone

CAT#: SC206303

3' UTR clone of ring finger protein 103 (RNF103) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KF1 (RNF103) (NM_005667) Human 3' UTR Clone
Vector pMirTarget
Synonyms HKF-1; KF-1; KF1; ZFP-103; ZFP103
ACCN NM_005667
Insert Size 475 bp
Sequence Data
>SC206303 3’UTR clone of NM_005667
The sequence shown below is from the reference sequence of NM_005667. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCCCTTGTCAAATGATGTCCCATCTTAACCATGTGCAATTTGTCCTTTATAAGCTTTGAGTATCTTA
CAGCTTGCCTTTTTAATGTTAGTCACAATGTTTTTGTGGTTTGAAGTTTAGTTTAATGTTAGTGCAGTG
ACGGGAAATACACATTATGCTAATGTTGATGACAGAATTTATTTGGTTGCCTTGTGTGTTAATTGAATG
CATACCTAATTGTAAAATTTTTTTATTTACAACATTGGAAATTCAGAAGTTAATGTTTTTTTGTAAGCA
CAAAAGAAGTATTATAGAAATTTATCCTAGCAAGACTTTACAAGATAGGATCAAATTCTAATGGAATTG
AGCCGGTTTCTTATCCTAAATGTTTCCTCCCTTTTTACAATCTCTGTCCAGCACCTCTTGGTTAAATAA
TGTATGCTGTGAGACATGAAATTAAAACAGACCTATGAAATAAATTATTTTAAAACCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005667.4
Synonyms HKF-1; KF-1; KF1; ZFP-103; ZFP103
Summary The protein encoded by this gene contains a RING-H2 finger, a motif known to be involved in protein-protein and protein-DNA interactions. This gene is highly expressed in normal cerebellum, but not in the cerebral cortex. The expression of the rat counterpart in the frontal cortex and hippocampus was shown to be induced by elctroconvulsive treatment (ECT) as well as chronic antidepressant treatment, suggesting that this gene may be a molecular target for ECT and antidepressants. The protein is a ubiquitin ligase that functions in the endoplasmic reticulum-associated degradation pathway. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream CHMP3 (charged multivesicular body protein 3) gene. [provided by RefSeq, Oct 2011]
Locus ID 7844
MW 18.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...