MRPS7 (NM_015971) Human 3' UTR Clone

CAT#: SC206367

3' UTR clone of mitochondrial ribosomal protein S7 (MRPS7) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MRPS7 (NM_015971) Human 3' UTR Clone
Vector pMirTarget
Synonyms bMRP27a; COXPD34; MRP-S; MRP-S7; RP-S7; RPMS7; S7mt
ACCN NM_015971
Insert Size 483 bp
Sequence Data
>SC206367 3’UTR clone of NM_015971
The sequence shown below is from the reference sequence of NM_015971. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTGCCCTGGCCCACTACCGCTGGTGGTAGAGTCTCCAGGAGGAGCCCAGGGCCCTCTGCCGCAAGAAA
CAGTGTGAGCTACTGCCACGCTGAAAACTACCTGTGGGTTAAGGATGTAGTTCCTTTGTAAGGGTGGGC
AGGCCTCGTAAGAAAGATGTAGCAGCATATTCACTATCCGTTAATCCTTCTTTCTTTGAGGCTGGAACT
TGCTCTCTCTGCCCCTATTTCCTTGTAAAGAGGGAGCACATTGACTTGGGAATTTCCTCCAGGAAACTC
AGGGCTGTTTTCTCTTCCCTTAGGTTGGGGCGGACCTTTGGATATATAAAGGAAGCAGTTTTAGTATCA
GAAAAGATTTATTAGAAAATTCTCACGCTGAACTGGTGTAGCATGTGGTGCAGCATTCAGTGAAACTGG
CTGGAGGAAATAGGCTTGTTTCCAGAGTTGTCCTTATACAAAATGTATAAAAAGCAGTTTCTGGTGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015971.4
Synonyms bMRP27a; COXPD34; MRP-S; MRP-S7; RP-S7; RPMS7; S7mt
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. In the prokaryotic ribosome, the comparable protein is thought to play an essential role in organizing the 3' domain of the 16 S rRNA in the vicinity of the P- and A-sites. Pseudogenes corresponding to this gene are found on chromosomes 8p and 12p. [provided by RefSeq, Jul 2008]
Locus ID 51081
MW 18.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...