C3orf37 (HMCES) (NM_001006109) Human 3' UTR Clone

CAT#: SC206541

3' UTR clone of chromosome 3 open reading frame 37 (C3orf37) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name C3orf37 (HMCES) (NM_001006109) Human 3' UTR Clone
Vector pMirTarget
Synonyms C3orf37; DC12; SRAPD1
ACCN NM_001006109
Insert Size 513 bp
Sequence Data
>SC206541 3’UTR clone of NM_001006109
The sequence shown below is from the reference sequence of NM_001006109. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTGTGGCCAAGCGTCCTTACAGCCAGTGACACAGGACTTTCAGAGACCAAGGCCAGGGTCTGCTGCAC
TGCTGTTCTGATAATAGGTTCTTAACATTGTATGTATATGTGTTTGCTTTGGGAGGAGGTGGCACTGTG
TTAGTTGACAGTTGTGGGCTCATGTAGTCTTTTTTGCCATGAGTAGGAGCCCCTAGTGGGGCTGGTGGA
CAGCTTTGGAAGAGGTGTCCTGCTGCTGTTACCAGCCATGTGGGCCCCATAGGGGCACTGCGCCTGCTG
CCCTTTCCTGGCAGGGCTGGTGGAGTCTTCCCTCAAAGCATGCCTTACCCAGCTGGGAAGTCTCTGCCC
TGATCTGGTACTCCTTGTAGTAAGCTGTTTTCTGCTCAGCCACTGGGCTCTTTCACTTTTTTAGTTCTT
AAAAATTTATTTTTAAGTTCTAAAATAAAATAAAAATAAGTTCTTAAAATTTATTTTTTTCCTGAATAA
ATTGTATTTGGTAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001006109.1
Synonyms C3orf37; DC12; SRAPD1
Summary Sensor of abasic sites in single-stranded DNA (ssDNA) required to preserve genome integrity by promoting error-free repair of abasic sites (PubMed:30554877). Acts as an enzyme that recognizes and binds abasic sites in ssDNA at replication forks and chemically modifies the lesion by forming a covalent cross-link with DNA (PubMed:30554877). The HMCES DNA-protein cross-link is then degraded by the proteasome (PubMed:30554877). Promotes error-free repair of abasic sites by acting as a 'suicide' enzyme that is degraded, thereby protecting abasic sites from translesion synthesis (TLS) polymerases and endonucleases that are error-prone and would generate mutations and double-strand breaks (PubMed:30554877). Acts as a protease: mediates autocatalytic processing of its N-terminal methionine in order to expose the catalytic cysteine (By similarity). Specifically binds 5-hydroxymethylcytosine (5hmC)-containing DNA in stem cells (By similarity). May act as an endonuclease that specifically cleaves 5hmC-containing DNA; additional experiments are however required to confirm this activity in vivo (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 56941
MW 18.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...