RPL23A (NM_000984) Human 3' UTR Clone

CAT#: SC206550

3' UTR clone of ribosomal protein L23a (RPL23A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL23A (NM_000984) Human 3' UTR Clone
Vector pMirTarget
Synonyms L23A; MDA20
ACCN NM_000984
Insert Size 508 bp
Sequence Data
>SC206550 3’UTR clone of NM_000984
The sequence shown below is from the reference sequence of NM_000984. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGTTGCCAACAAAATTGGGATCATCTAAACTGAGTCCAGCTGCCTAATTCTGAATATATATATATAT
ATATCTTTTCACCATATACATGCCTGTCTGTCAATTTCTGGTTGGGCTGGGAGGCCACACACACACACT
GACATGACAGGGCTTGGGCAAGACTCCTGTTCTACTTATCCTTTTGAAATACCTCACCCTGCCACTCCA
CCATGTATGATCATTCCAGAGATCTTTGTGACTAGAGTTAGTGTCCTAGGAAAACCAGAACTCAGAACT
TGCCTCCATGGTTGAGTAACAAGCTGTACAAGAACCCCTTTTATCCCTGGAAGAGGCTGTGTATGAAAC
CAATGCCCAGGGTTTGAAGGGTGTTAGCATCCATTTCAGGGGAGTGTGGATTGGCTGGCTCTCTGGTAG
CATTTTGTCCTCACACACCCATCTACTATGTCCAACCGGTCTGTCTGCTTCCCTCACCCCTTGCCCAAT
AAAGGACAAGGACTTCAGAGGAGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000984.6
Synonyms L23A; MDA20
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L23P family of ribosomal proteins. It is located in the cytoplasm. The protein may be one of the target molecules involved in mediating growth inhibition by interferon. In yeast, the corresponding protein binds to a specific site on the 26S rRNA. This gene is co-transcribed with the U42A, U42B, U101A, and U101B small nucleolar RNA genes, which are located in its third, first, second, and fourth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 6147
MW 18.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...