SELS (SELENOS) (NM_018445) Human 3' UTR Clone

CAT#: SC207957

3' UTR clone of selenoprotein S (SELS) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SELS (SELENOS) (NM_018445) Human 3' UTR Clone
Vector pMirTarget
Synonyms AD-015; ADO15; SBBI8; SELS; SEPS1; VIMP
ACCN NM_018445
Insert Size 610 bp
Sequence Data
>SC207957 3’UTR clone of NM_018445
The sequence shown below is from the reference sequence of NM_018445. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGGCCCGTCATCTGGCGGATGAGGCTAAGAATCTTGTTAGTGTCACTTTTGACATTAGCAAGATGAA
CCCTTAACCCTCGATTCAATTGCCTTACGCACGCTTTTCACAGTGACTAGCCAAGGGGAGGTGGGGTTG
ATTTCTGTTCCTAACTACACCTGCATATGTCAGGGCTCCAGTCAGCAAAAGGTATAGATGTTGCCTCTA
GGCATGAGGTCATTGGTCACATTCTACTTGGAGACAGTGATTGCATTCATTGATTTCATGGTTAATTGC
TAGTTGGTAGGTAAAGGCCTCTAGATGATTAGCAATCTTGATAAAAGAGGCCTAGTAATGTTCTTTTGA
GGTTAGAAATCCTTGCTGCTAGGACAGTCTCTGTGACAGGTTGCGTTGAATGATGTCTTCCTTATCAAT
GGTGAGCCCACCAGTGAGGATTACTGATGTGGACAGTTGATGGGGTTTGTTTCTGTATATTTATTTTTA
TGTACAGAACTTTGTAAAAACGAAACTATTTAAAAAACAAGAATAACATTTTTAGCATCTTTATTCAAG
GAGATTTATGGACTTCAATTTGTCTATCAAACATTAAATAGCTTTTTATTACAACCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018445.6
Synonyms AD-015; ADO15; SBBI8; SELS; SEPS1; VIMP
Summary This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion. An alternatively spliced transcript variant, lacking the SECIS element and encoding a non-Sec containing shorter isoform, has been described for this gene (PMID:23614019). [provided by RefSeq, Jul 2017]
Locus ID 55829
MW 22.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...