TATA binding protein (TBP) (NM_003194) Human 3' UTR Clone

CAT#: SC208221

3' UTR clone of TATA box binding protein (TBP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TATA binding protein (TBP) (NM_003194) Human 3' UTR Clone
Vector pMirTarget
Synonyms GTF2D; GTF2D1; HDL4; SCA17; TFIID
ACCN NM_003194
Insert Size 624 bp
Sequence Data
>SC208221 3’UTR clone of NM_003194
The sequence shown below is from the reference sequence of NM_003194. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTCTAAAGGGATTCAGGAAGACGACGTAATGGCTCTCATGTACCCTTGCCTCCCCCACCCCCTTCTTT
TTTTTTTTTTAAACAAATCAGTTTGTTTTGGTACCTTTAAATGGTGGTGTTGTGAGAAGATGGATGTTG
AGTTGCAGGGTGTGGCACCAGGTGATGCCCTTCTGTAAGTGCCCACCGCGGGATGCCGGGAAGGGGCAT
TATTTGTGCACTGAGAACACCGCGCAGCGTGACTGTGAGTTGCTCATACCGTGCTGCTATCTGGGCAGC
GCTGCCCATTTATTTATATGTAGATTTTAAACACTGCTGTTGACAAGTTGGTTTGAGGGAGAAAACTTT
AAGTGTTAAAGCCACCTCTATAATTGATTGGACTTTTTAATTTTAATGTTTTTCCCCATGAACCACAGT
TTTTATATTTCTACCAGAAAAGTAAAAATCTTTTTTAAAAGTGTTGTTTTTCTAATTTATAACTCCTAG
GGGTTATTTCTGTGCCAGACACATTCCACCTCTCCAGTATTGCAGGACAGAATATATGTGTTAATGAAA
ATGAATGGCTGTACATATTTTTTTCTTTCTTCAGAGTACTCTGTACAATAAATGCAGTTTATAAAAGTG
TTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003194.5
Synonyms GTF2D; GTF2D1; HDL4; SCA17; TFIID
Summary Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]
Locus ID 6908
MW 24.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...