Nus1 (NM_030250) Mouse Untagged Clone

CAT#: MC200036

Nus1 (untagged) - Mouse nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) (Nus1), (10ug)



  "NM_030250" in other vectors (5)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-Nus1 Antibody
    • 50 ug

CNY 5200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1600027K07Rik; AU019165; AW538011; BC003223; D10Ertd438e
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC003223 sequence for NM_030250
CCCACGCGTCCGGTTGGCAGTGGCGAGGGGCTCGGGCGCGGGGGGTGGGGGGACGCGGAGCGATGGCCCG CGCCGGCCGCTGGGGCGGATAAGACCCTGTCGCGCCGCGGGTGTGGGCCGGAGGGAGGTGACGGTGCCCG AGCGCCACAGGAGTATGACGGGGCTGTACGAGCTGGTGTGGCGGGTGCTGCACGCGCTGCTCTGCCTGCA CCTCACGCTCACCTCCTGGCTCCGCGTTCGCTTCGGCACCTGGAACTGGATCTGGCGGCGCTGCTGTCGC GCCGCCTCCGCCGCGGTCCTAGCGCCGCTCGGCTTCACGCTCCGCAAGCCCCGGGCCGTCGGCAGGAACC GGCGTCATCACCGGCACCCGCACGGGGGACCGGGACCGGGACCGGGACCGGCCGCCACCCATCCTCGGCT GCGCTGGCGCGCGGACGTCCGGTCCCTGCAGAAGCTGCCGGTGCACATGGGCCTGTTGGTCACGGAGGAA GTGCAGGAGCCCAGCTTCTCAGACATCGCCAGCCTCGTGGTGTGGTGTATGGCCGTGGGGATCTCCTACA TTAGCGTCTACGACCACCAAGGTATTTTCAAGAGAAATAATTCCAGATTGATGGATGAAATTTTAAAACA GCAACAGGAACTTTTGGGCCAAGATTGTTCCAAATACTCAGCAGAGTTTGCAAATAGTAATGACAAAGAC GATCAAGATTTAAATTGCCCTTCGGCAGTGAAGGTGCTGTCCCCAGAAGATGGAAAAGCGGATATTGTGA GAGCTGCCCAGGATTTTTGCCAGTTAGTAGCCCAGCAGCAGAGGAAGCCCACAGATCTGGATGTAGATCT GCTAGGCAGCTTACTTAGTTCACATGGGTTCCCTGATCCTGACTTAGTGTTGAAGTTTGGTCCTGTGGAC AGCACATTAGGCTTTCTTCCCTGGCAAATCAGATTGACTGAGATCGTCTCTCTGCCTTCTCACCTAAACA TCAGCTATGAGGACTTCTTCTCCGCCCTTCGGCAGTATGCAGCTTGCGAACAGCGACTGGGAAAGTAATG GTCCCTACTTGCATAATTTGACTTCAGGCTTTTGGAGAAAAAGGACCCAAGTGACACTGATGTTTACAAA GTACCTATAAAACCCTGTACACACCTAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_030250
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC003223, AAH03223
RefSeq Size 1168 bp
RefSeq ORF 894 bp
Locus ID 52014
UniProt ID Q99LJ8
Gene Summary With DHDDS, forms the dehydrodolichyl diphosphate synthase (DDS) complex, an essential component of the dolichol monophosphate (Dol-P) biosynthetic machinery. Both subunits contribute to enzymatic activity, i.e. condensation of multiple copies of isopentenyl pyrophosphate (IPP) to farnesyl pyrophosphate (FPP) to produce dehydrodolichyl diphosphate (Dedol-PP), a precursor of dolichol phosphate which is utilized as a sugar carrier in protein glycosylation in the endoplasmic reticulum (ER). Regulates the glycosylation and stability of nascent NPC2, thereby promoting trafficking of LDL-derived cholesterol. Acts as a specific receptor for the N-terminus of Nogo-B, a neural and cardiovascular regulator.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...