Fabp5 (BC002008) Mouse Untagged Clone
CAT#: MC200066
Fabp5 (untagged) - Mouse fatty acid binding protein 5, epidermal (cDNA clone MGC:5786 IMAGE:3490535), (10ug)
CNY 1800.00
货期*
现货
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | E-FABP; Fabpe; Klbp; mal1; PA-FABP |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002008
CGCGTCTCTGCTGCTTTTGTGCTCTCCCTCCCGCCATGGCCAGCCTTAAGGATCTCGAAGGGAAGTGGCG CCTGATGGAAAGCCACGGCTTTGAGGAGTACATGAAAGAGCTAGGAGTAGGACTGGCTCTTAGGAAGATG GCTGCCATGGCCAAGCCAGACTGTATCATTACGTGTGATGGCAACAACATCACGGTCAAAACCGAGAGCA CAGTGAAGACGACCGTGTTCTCTTGTAACCTGGGAGAGAAGTTTGATGAAACGACAGCTGATGGCAGAAA AACTGAGACGGTCTGCACCTTCCAAGACGGTGCCCTGGTCCAGCACCAGCAATGGGACGGGAAGGAGAGC ACGATAACAAGAAAACTGAAGGATGGGAAGATGATCGTGGAGTGTGTCATGAACAATGCCACCTGCACTC GGGTCTATGAGAAGGTGCAATGAGGGCTTCCTCGTCATCCTGGACAGGAGTTAGCTGCCAGAGTGAATAT GCTCAATTCAGTGAGCGGTCAAATGCAACAAACAGCTTCACTTCTTTGGTTTTATTTTTCATGACTGTTG AGTTCTCTTTATCACAAACACTTTACATGGACCTTCATGTCAAACTTGGTTTACCCAGGATCATTCCTTT GGTTAGTAAATAAACGTGTTAGTGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | BC002008 |
Insert Size | 408 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002008, AAH02008 |
RefSeq Size | 713 bp |
RefSeq ORF | 408 bp |
Locus ID | 16592 |
Gene Summary | The protein encoded by this gene is part of the fatty acid binding protein family (FABP). FABPs are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands and participate in fatty acid uptake, transport, and metabolism. In humans this gene has been associated with psoriasis and type 2 diabetes. In mouse deficiency of this gene in combination with a deficiency in Fabp4 confers protection against atherosclerosis, diet-induced obesity, insulin resistance and experimental autoimmune encephalomyelitis (the mouse model for multiple sclerosis). Alternative splicing results in multiple transcript variants that encode different protein isoforms. The mouse genome contains many pseudogenes similar to this locus. [provided by RefSeq, Jan 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200811 | Fabp5 (tGFP-tagged) - Mouse fatty acid binding protein 5, epidermal (cDNA clone MGC:5786 IMAGE:3490535) |
CNY 2800.00 |
Customer
Reviews
Loading...