Prmt1 (BC002249) Mouse Untagged Clone

CAT#: MC200097

Prmt1 (untagged) - Mouse protein arginine N-methyltransferase 1 (cDNA clone MGC:7572 IMAGE:3493263), (10ug)



  "BC002249" in other vectors (4)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6720434D09Rik; AW214366; Hrmt1l2; Mrmt1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002249
GCAGCCGAGGCCGCGAACTGCATCATGGAGGTTTCCTGTGGCCAAGCAGAAAGTAGTGAGAAGCCCAACG CTGAGGACATGACATCCAAAGACTACTACTTTGACTCCTATGCCCACTTTGGCATCCACGAGGAGATGCT GAAGGATGAGGTGCGCACCCTCACATACCGCAACTCCATGTTTCACAATCGGCATCTCTTCAAAGACAAG GTGGTGCTGGACGTGGGCTCAGGCACTGGCATCCTCTGCATGTTTGCTGCCAAGGCGGGGGCCCGCAAGG TTATTGGGATTGAGTGTTCCAGTATCTCCGATTATGCTGTGAAGATTGTCAAAGCCAACAAGTTAGACCA TGTGGTGACCATCATCAAGGGCAAGGTGGAGGAGGTGGAGCTGCCCGTGGAGAAGGTGGACATCATCATC AGCGAGTGGATGGGTTACTGCCTCTTCTACGAGTCCATGCTCAACACCGTGCTGCATGCTCGGGACAAGT GGCTGGCACCCGATGGCCTCATCTTCCCAGACCGGGCCACCTTGTATGTGACAGCCATTGAGGACCGACA ATATAAAGACTACAAGATCCACTGGTGGGAGAACGTGTATGGCTTTGATATGTCCTGCATTAAAGACGTG GCCATCAAGGAGCCCCTGGTGGACGTGGTGGACCCAAAGCAGCTGGTCACCAATGCCTGCCTCATAAAGG AGGTGGACATCTACACAGTCAAGGTGGAGGACCTGACCTTCACCTCCCCCTTCTGCCTGCAAGTGAAGAG GAACGACTACGTGCATGCGTTGGTGGCTTACTTCAACATCGAGTTCACCCGATGCCACAAGAGGACCGGC TTCTCCACCAGTCCTGAGTCCCCGTACACACACTGGAAGCAGACTGTGTTCTACATGGAGGACTACCTAA CAGTGAAGACTGGCGAGGAGATCTTTGGCACCATTGGAATGAGGCCCAATGCCAAAAACAATCGTGACTT GGACTTTACCATCGACCTGGACTTCAAGGGTCAGCTGTGTGAGCTCTCTTGTTCCACCGACTACCGGATG CGCTGAGGAGGTGCCAGGCTGGCCCTCCTGCAGAAGGGGGCTCGGGGGGATGGGCTTGGGGGATGGGGGG GTACATCGTGACTGTGTTTTTCATAACTTATGTTTTTATATGGTTGCGTTTATGCCAATAAATCCTCAGC TGACCATGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC002249
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002249, AAH02249
RefSeq Size 1213 bp
RefSeq ORF 1032 bp
Locus ID 15469
Gene Summary Arginine methyltransferase that methylates (mono and asymmetric dimethylation) the guanidino nitrogens of arginyl residues present in proteins such as ESR1, histone H2, H3 and H4, ILF3, HNRNPA1, HNRNPD, NFATC2IP, SUPT5H, TAF15, EWS, HABP4 and SERBP1 (PubMed:15327772, PubMed:19858291). Constitutes the main enzyme that mediates monomethylation and asymmetric dimethylation of histone H4 'Arg-4' (H4R3me1 and H4R3me2a, respectively), a specific tag for epigenetic transcriptional activation (By similarity). Methylates H4R3 in genes involved in glioblastomagenesis in a CHTOP- and/or TET1-dependent manner (By similarity). May be involved in the regulation of TAF15 transcriptional activity, act as an activator of estrogen receptor (ER)-mediated transactivation, play a key role in neurite outgrowth and act as a negative regulator of megakaryocytic differentiation, by modulating p38 MAPK pathway (By similarity). Methylates RBM15, promoting ubiquitination and degradation of RBM15 (By similarity). Methylates CHTOP and this methylation is critical for its 5-hydroxymethylcytosine (5hmC)-binding activity (PubMed:19858291).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...