Spsb2 (NM_013539) Mouse Untagged Clone
CAT#: MC200175
Spsb2 (untagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI461677; C9; Grcc; Grcc9; SS; SSB2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002005 sequence for NM_013539
GGAGGGACAAGAGGTTACCCACTCAAAGAGTGTGCTCCACAAAGCATGCGCGCTTGTCCACGTCTGGAGT CGTCACTTATTTTTTGCCTGGATTCTTTGTAGCCGGGGACGATCCGGAGCTCAACTTTCAAAAGCGAGAC GCCCCAGCAAGCCTGTTTTGAGAAGTTCTTCAGCGGCTCTCCTCATGGGCCAGACGGCCCTGGCAAGGGG CAGCAGCAGCACCCCTACCTCGCAGGCTCTGTACTCGGACTTCTCTCCTCCCGAGGGCTTGGAGGAGCTC CTGTCTGCTCCCCCTCCTGACCTGGTTGCCCAACGGCACCACGGCTGGAACCCCAAGGATTGCTCCGAGA ACATCGATGTCAAGGAAGGGGGTCTGTGCTTTGAGCGGCGCCCTGTGGCCCAGAGCACTGATGGAGTCCG GGGGAAACGGGGCTATTCGAGAGGTCTGCACGCCTGGGAGATCAGCTGGCCCCTGGAGCAAAGGGGCACA CACGCCGTGGTGGGCGTGGCCACCGCCCTCGCCCCGCTGCAGGCTGACCACTATGCGGCGCTTTTGGGCA GCAACAGCGAGTCCTGGGGCTGGGATATTGGGCGGGGAAAATTGTATCATCAGAGTAAGGGCCTCGAGGC CCCCCAGTATCCAGCTGGACCTCAGGGTGAGCAGCTAGTGGTGCCAGAGAGACTGCTGGTGGTTCTGGAC ATGGAGGAGGGGACTCTTGGCTACTCTATTGGGGGCACGTACCTGGGACCAGCCTTCCGTGGACTGAAGG GGAGGACCCTCTATCCCTCTGTAAGTGCTGTTTGGGGCCAGTGCCAGGTCCGCATCCGCTACATGGGCGA AAGAAGAGTGGAGGAACCACAATCCCTTCTGCACCTGAGCCGCCTGTGTGTGCGCCATGCTCTGGGGGAC ACCCGGCTGGGTCAAATATCCACTCTGCCTTTGCCCCCTGCCATGAAGCGCTATCTGCTCTACAAATGAC CCAGTAGTACAGGGTGTGCTGGCACCCTACCGTGGGGACAGGTGGAGAGGCACCCGCTGGCCTAGACAAC TTTAAAAAGCTGGTGAAGCTGGGGGGGGGGGGCTGGACCCCTTCACCTCCCCTTCTCACAGGAGCAAGAC ATATAGAAATGATATTAAACACCATGGCAGCCTGGGACAAAGAGGTTTTTGAAGTAAAAAATGAGATGTA TTGTCAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_013539 |
| Insert Size | 795 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002005, AAH02005 |
| RefSeq Size | 1212 bp |
| RefSeq ORF | 795 bp |
| Locus ID | 14794 |
| UniProt ID | O88838 |
| Gene Summary | This gene encodes a member of the SSB family of proteins that contain a central SPRY (repeats in splA and ryanodine receptors) domain and a C-terminal SOCS (suppressor of cytokine signaling) box. The encoded protein is an adaptor protein in the E3 ubiquitin ligase complex that ubiquitinates inducible nitric oxide synthase and targets it for proteasomal degradation. Mice lacking the encoded protein exhibit lower blood urea nitrogen levels and mild thrombocytopenia due to reduced platelet production. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1, 2, 3 and 4 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203482 | Spsb2 (tGFP-tagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2) |
CNY 2850.00 |
|
| MR203482 | Spsb2 (Myc-DDK-tagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2) |
CNY 2400.00 |
|
| MR203482L3 | Lenti ORF clone of Spsb2 (Myc-DDK-tagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2) |
CNY 4750.00 |
|
| MR203482L4 | Lenti ORF clone of Spsb2 (mGFP-tagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2) |
CNY 4750.00 |
