Nudt21 (NM_026623) Mouse Untagged Clone

CAT#: MC200256

Nudt21 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 21 (Nudt21), (10ug)



  "NM_026623" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 25kDa; 3110048P04Rik; 5730530J16Rik; AU014860; AW549947; Cpsf5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC008270 sequence for NM_026623
CGCCTCTTGCTCTCGACTGTTAATGGCGGGTGGTGGCTGCTGAGCGGGACGCAGATAACCGCTGCCCGCC CCGCGGACGTCTCCCCGGGCCCCCGCTTTCTGCACGTCCCCGGCGTCGGAGCTGTTCAGCATGTCTGTGG TGCCGCCCAATCGCTCGCAGACGGGCTGGCCCCGGGGGGTCAACCAGTTCGGCAACAAGTACATCCAGCA GACCAAGCCCCTCACCCTGGAGCGCACCATTAATCTGTACCCGCTTACCAATTATACTTTTGGTACAAAG GAGCCCCTCTATGAGAAGGACAGCTCTGTTGCAGCCAGATTTCAGCGCATGAGGGAGGAATTTGATAAGA TTGGGATGAGAAGGACTGTAGAAGGGGTTCTGATTGTTCATGAACACCGCCTGCCCCACGTGCTCCTGCT GCAGCTGGGGACAACTTTCTTCAAATTACCTGGTGGGGAACTTAACCCAGGAGAAGATGAAGTTGAAGGA CTAAAACGCTTAATGACAGAGATACTTGGTCGTCAAGATGGAGTCCTGCAAGACTGGGTCATTGATGACT GCATTGGGAACTGGTGGAGACCAAATTTTGAACCTCCTCAGTATCCGTATATTCCTGCACATATAACAAA ACCCAAGGAACATAAGAAGTTGTTTCTGGTTCAGCTTCAAGAGAAAGCCTTGTTTGCAGTCCCTAAAAAT TACAAGCTGGTAGCTGCACCATTGTTTGAGCTGTATGACAATGCACCGGGGTATGGACCCATCATTTCTA GTCTTCCTCAGCTGCTGAGCAGGTTCAATTTTATATACAACTGAATTCCTGTATGCAGAAGTAAAAGAAG CCGTCTCTATGAGCACAGCTTACACGTGTAGAAGAGTAACTGTAGAACAAGTTTTGGTTTTCTCTTGTTC CCTAAATTGCCACCACCTTCCTGTTTGAAGAGTAAAATGAATATGACCGAGATAGTGGTGGAAACATGTG GCAGTGTTCATTAGCTTTTGGTTCTACTCATACTTTTTTTTGTACATTAAAGAAAGTGAATTTCTTATTT GTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026623
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC008270, AAH08270
RefSeq Size 1097 bp
RefSeq ORF 684 bp
Locus ID 68219
UniProt ID Q9CQF3
Gene Summary Component of the cleavage factor Im (CFIm) complex that functions as an activator of the pre-mRNA 3'-end cleavage and polyadenylation processing required for the maturation of pre-mRNA into functional mRNAs. CFIm contributes to the recruitment of multiprotein complexes on specific sequences on the pre-mRNA 3'-end, so called cleavage and polyadenylation signals (pA signals). Most pre-mRNAs contain multiple pA signals, resulting in alternative cleavage and polyadenylation (APA) producing mRNAs with variable 3'-end formation. The CFIm complex acts as a key regulator of cleavage and polyadenylation site choice during APA through its binding to 5'-UGUA-3' elements localized in the 3'-untranslated region (UTR) for a huge number of pre-mRNAs. NUDT21/CPSF5 activates indirectly the mRNA 3'-processing machinery by recruiting CPSF6 and/or CPSF7. Binds to 5'-UGUA-3' elements localized upstream of pA signals that act as enhancers of pre-mRNA 3'-end processing. The homodimer mediates simultaneous sequence-specific recognition of two 5'-UGUA-3' elements within the pre-mRNA (By similarity). Plays a role in somatic cell fate transitions and pluripotency by regulating widespread changes in gene expression through an APA-dependent function(PubMed:29249356). Binds to chromatin (PubMed:18032416). Binds to, but does not hydrolyze mono- and di-adenosine nucleotides (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...