Pycard (NM_023258) Mouse Untagged Clone
CAT#: MC200275
Pycard (untagged) - Mouse PYD and CARD domain containing (Pycard), (10ug)
CNY 2400.00
Product images
                    
                Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | 9130417A21Rik; Asc; CARD5; masc; TMS-1; TNS1 | 
| Vector | PCMV6-Kan/Neo | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >BC008252 sequence for NM_023258 
CAGCAGGCGAGCAGCAGCAAGAGTAAAAGGTGACCGCGGCTGCCCACCCCAGAGCCATGGGGCGGGCACG AGATGCCATCCTGGACGCTCTTGAAAACTTGTCAGGGGATGAACTCAAAAAGTTCAAGATGAAGCTGCTG ACAGTGCAACTGCGAGAAGGCTATGGGCGCATCCCACGCGGGGCCCTGCTGCAGATGGACGCCATAGATC TCACTGACAAACTTGTCAGCTACTATCTGGAGTCGTATGGCTTGGAGCTCACAATGACTGTGCTTAGAGA CATGGGCTTACAGGAGCTGGCTGAGCAGCTGCAAACGACTAAAGAAGAGTCTGGAGCTGTGGCAGCTGCA GCCAGTGTCCCTGCTCAGAGTACAGCCAGAACAGGACACTTTGTGGACCAGCACAGGCAAGCACTCATTG CCAGGGTCACAGAAGTGGACGGAGTGCTGGATGCTTTGCATGGCAGTGTGCTGACTGAAGGACAGTACCA GGCAGTTCGTGCAGAGACCACCAGCCAAGACAAGATGAGGAAGCTCTTCAGCTTTGTTCCATCCTGGAAC CTGACCTGCAAGGACTCCCTCCTCCAGGCCTTGAAGGAAATACATCCCTACTTGGTGATGGACCTGGAGC AGAGCTGAGGTATCTTTTCCAGCTACATTATCTAGCTCCTGACTTTGTATACACAATTTTTGAAAAAACA ATTTGTATTTGTGTTTAAAAAAAAAAAAAAAA  | 
        
| Restriction Sites | RsrII-NotI | 
| ACCN | NM_023258 | 
| Insert Size | 582 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | BC008252, AAH08252 | 
| RefSeq Size | 732 bp | 
| RefSeq ORF | 582 bp | 
| Locus ID | 66824 | 
| UniProt ID | Q9EPB4 | 
| Gene Summary | Functions as key mediator in apoptosis and inflammation. Promotes caspase-mediated apoptosis involving predominantly caspase-8 and also caspase-9 in a probable cell type-specific manner. Involved in activation of the mitochondrial apoptotic pathway, promotes caspase-8-dependent proteolytic maturation of BID independently of FADD in certain cell types and also mediates mitochondrial translocation of BAX and activates BAX-dependent apoptosis coupled to activation of caspase-9, -2 and -3. Involved in macrophage pyroptosis, a caspase-1-dependent inflammatory form of cell death and is the major constituent of the ASC pyroptosome which forms upon potassium depletion and rapidly recruits and activates caspase-1. In innate immune response believed to act as an integral adapter in the assembly of the inflammasome which activates caspase-1 leading to processing and secretion of proinflammatory cytokines. The function as activating adapter in different types of inflammasomes is mediated by the pyrin and CARD domains and their homotypic interactions. Required for recruitment of caspase-1 to inflammasomes containing certain pattern recognition receptors, such as NLRP2, NLRP3, AIM2 and probably IFI16. In the NLRP1 and NLRC4 inflammasomes seems not be required but facilitates the processing of procaspase-1. In cooperation with NOD2 involved in an inflammasome activated by bacterial muramyl dipeptide leading to caspase-1 activation. May be involved in DDX58-triggered proinflammatory responses and inflammasome activation. In collaboration with AIM2 which detects cytosolic double-stranded DNA may also be involved in a caspase-1-independent cell death that involves caspase-8. In adaptive immunity may be involved in maturation of dendritic cells to stimulate T-cell immunity and in cytoskeletal rearrangements coupled to chemotaxis and antigen uptake may be involved in post-transcriptional regulation of the guanine nucleotide exchange factor DOCK2; the latter function is proposed to involve the nuclear form. Also involved in transcriptional activation of cytokines and chemokines independent of the inflammasome; this function may involve AP-1, NF-kappa-B, MAPK and caspase-8 signaling pathways. For regulation of NF-kappa-B activating and inhibiting functions have been reported. Modulates NF-kappa-B induction at the level of the IKK complex by inhibiting kinase activity of CHUK and IKBK. Proposed to compete with RIPK2 for association with CASP1 thereby down-regulating CASP1-mediated RIPK2-dependent NF-kappa-B activation and activating interleukin-1 beta processing. Modulates host resistance to DNA virus infection, probably by inducing the cleavage of and inactivating CGAS in presence of cytoplasmic double-stranded DNA (PubMed:28314590).[UniProtKB/Swiss-Prot Function] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG201872 | Pycard (tGFP-tagged) - Mouse PYD and CARD domain containing (Pycard) | 
                                                     CNY 4000.00  | 
                                            |
| MR201872 | Pycard (Myc-DDK-tagged) - Mouse PYD and CARD domain containing (Pycard) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 2400.00  | 
                                            |
| MR201872L3 | Lenti ORF clone of Pycard (Myc-DDK-tagged) - Mouse PYD and CARD domain containing (Pycard) | 
                                                     CNY 4750.00  | 
                                            |
| MR201872L4 | Lenti ORF clone of Pycard (mGFP-tagged) - Mouse PYD and CARD domain containing (Pycard) | 
                                                     CNY 4800.00  | 
                                            
