Ebi3 (NM_015766) Mouse Untagged Clone

CAT#: MC200566

Ebi3 (untagged) - Mouse Epstein-Barr virus induced gene 3 (Ebi3), (10ug)



  "NM_015766" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms EBI-3; IL-27
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC008209 sequence for NM_015766
ACACACAGCAGCTGGTGACAGAATCAGGGTTCCCGTCACCATCATCATCTCCTGCCCCATACACTGGACA ACTGAGCCACACTGGGCAGGTCCTTCCCTGGGGCCAGGTTCCCTGTGTGAGTCCCCTGTCCTTCACCCTC TCTCTGATGGGTCACTAACTCGGATCCAAGGAACAGAGCCACAGAGCATGTCCAAGCTGCTCTTCCTGTC ACTTGCCCTCTGGGCCAGCCGCTCCCCTGGTTACACTGAAACAGCTCTCGTGGCTCTAAGCCAGCCCAGA GTGCAATGCCATGCTTCTCGGTATCCCGTGGCCGTGGACTGCTCCTGGACTCCTCTCCAGGCTCCCAACT CCACCAGATCCACGTCCTTCATTGCCACTTACAGGCTCGGTGTGGCCACCCAGCAGCAGAGCCAGCCCTG CCTACAACGGAGCCCCCAGGCCTCCCGATGCACCATCCCCGACGTGCACCTGTTCTCCACGGTGCCCTAC ATGCTAAATGTCACTGCAGTGCACCCAGGCGGCGCCAGCAGCAGCCTCCTAGCCTTTGTGGCTGAGCGAA TCATCAAGCCGGACCCTCCGGAAGGCGTGCGCCTGCGCACAGCGGGACAGCGCCTGCAGGTGCTCTGGCA TCCCCCTGCTTCCTGGCCCTTCCCGGACATCTTCTCTCTCAAGTACCGACTCCGCTACCGGCGCCGAGGA GCCTCTCACTTCCGCCAGGTGGGACCCATTGAAGCCACGACTTTCACCCTCAGGAACTCGAAACCCCATG CCAAGTATTGCATCCAGGTGTCAGCTCAGGACCTCACAGATTATGGGAAACCAAGTGACTGGAGCCTCCC TGGGCAAGTAGAAAGTGCACCCCATAAGCCCTGAAGAGGGACTGGATCCTTGATATCAGACCCTGATGTC GTCTACTTGAGGGTGGCAGGGTGGCCTGTCCTGAGTCTGAATACTGACTTTCCATGTACTGGGCTGCTCC GAAGCACTGGATAATTCACTTGACTTCTTCAGACCTCAATTTCCAACCCTGTGGGATGATCTTTCTTCTT CTGCCGGTGCGGGGCTTTGTGAACTTTGTGATTTAATTAGAAAGACGGATTAAATAAGAATCATCATCAA AAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_015766
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC008209, AAH08209
RefSeq Size 1131 bp
RefSeq ORF 687 bp
Locus ID 50498
UniProt ID O35228
Gene Summary Associates with IL27 to form the IL-27 interleukin, a heterodimeric cytokine which functions in innate immunity. IL-27 has pro- and anti-inflammatory properties, that can regulate T-helper cell development, suppress T-cell proliferation, stimulate cytotoxic T-cell activity, induce isotype switching in B-cells, and that has diverse effects on innate immune cells. Among its target cells are CD4 T-helper cells which can differentiate in type 1 effector cells (TH1), type 2 effector cells (TH2) and IL17 producing helper T-cells (TH17). It drives rapid clonal expansion of naive but not memory CD4 T-cells. It also strongly synergizes with IL-12 to trigger interferon-gamma/IFN-gamma production of naive CD4 T-cells, binds to the cytokine receptor WSX-1/TCCR. Another important role of IL-27 is its antitumor activity as well as its antiangiogenic activity with activation of production of antiangiogenic chemokines.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...