Eif3g (NM_016876) Mouse Untagged Clone

CAT#: MC200582

Eif3g (untagged) - Mouse eukaryotic translation initiation factor 3, subunit G (Eif3g), (10ug)



  "NM_016876" in other vectors (4)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 44kDa; D0Jmb4; eIF3-p44; Eif3s4; p44; TU-189B2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC008511 sequence for NM_016876
GGAGCTGCGTGGAGTTAAGACTTCGAGATGCCGACTGGCGACTTTGACTCGAAGCCCAGCTGGGCCGACC AGGTGGAGGAGGAGGGAGAGGACGACAAATGTGTCACCAGCGAGCTCCTGAAAGGAATCCCTCTGCCCAC CGGGGACACCAGTCCAGAGCCCGAGTTACTGCCCGGAGACCCGCTGCCACCTCCCAAGGAAGTCATCAAT GGGAACATAAAGACAGTGACTGAGTACAAGATAGAGGAAGATGGGAAGAAATTCAAGATTGTCAGAACCT TCAGGATTGAGACCCGGAAGGCATCAAAAGCTGTGGCAAGGAGGAAGAATTGGAAGAAGTTTGGCAACTC GGAGTTTGACCCACCGGGGCCCAATGTGGCCACTACCACAGTCAGTGATGACGTCTCTATGACATTCATC ACTAGCAAAGAGGACCTAAACTGTCAGGAGGAGGAGGACCCAATGAACAAGCTTAAGGGCCAGAAGATTG TGTCCTGCCGCATTTGCAAGGGCGACCATTGGACCACCCGTTGCCCCTACAAGGACACACTAGGACCCAT GCAGAAGGAGCTGGCTGAGCAGCTCGGCCTGTCTACTGGGGAGAAGGAGAAACTGCCAGGAGAGCTGGAG CCCGTGCAGGCCGCCCAGAGCAAGACAGGGAAGTATGTGCCCCCCAGCCTCCGGGACGGGGCCAGCCGCC GTGGGGAGTCCATGCAGCCAAACCGCAGAGCTGACGACAATGCCACCATCCGTGTCACTAACCTGTCCGA GGACACTCGTGAGACTGACTTGCAGGAACTCTTCCGGCCTTTCGGCTCCATCTCCCGAATCTACTTGGCC AAGGACAAGACTACTGGGCAGTCCAAGGGTTTTGCTTTTATCAGCTTTCACCGCCGGGAGGATGCTGCAC GTGCCATTGCAGGGGTGTCTGGTTTTGGCTACGACCATCTTATCCTCAATGTCGAGTGGGCCAAGCCATC AACGAATTAATAAGACATCTGCTACCTGCTGCTGTTGTCCAGCCCCTCAGGACAGACAGAAAGCTTCAGT AAACAGACTCCAAATGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_016876
Insert Size 963 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC008511, AAH08511
RefSeq Size 1126 bp
RefSeq ORF 963 bp
Locus ID 53356
UniProt ID Q9Z1D1
Gene Summary RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression. This subunit can bind 18S rRNA.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...