Ucp1 (NM_009463) Mouse Untagged Clone
CAT#: MC200793
Ucp1 (untagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI385626; Slc25a7; Ucp |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012701 sequence for NM_009463
CCACGCGTCCGCTGGGCTTAACGGGTCCTCCCTGCCCGAGCAAGAGGAAGGGACGCTCACCTTTGAGCTG CTCCACAGCGCCGCCTCTGCACTGGCACTACCTAGCCCAGGTGGCTCTGCAGGAGTCCGAAGTCGCGGGT TTCGTGCCCGCATCAGGCAACAGTGCCACTGTTGTCTTCAGGGCTGAGTCCTTTTGTTCTTGCACTCACG CCTCTCTGCCCTCCAAGCCAGGATGGTGAACCCGACAACTTCCGAAGTGCAACCCACCATGGGGGTCAAG ATCTTCTCAGCCGGAGTTTCAGCTTGCCTGGCAGATATCATCACCTTCCCGCTGGACACTGCCAAAGTCC GCCTTCAGATCCAAGGTGAAGGCCAGGCTTCCAGTACCATTAGGTATAAAGGTGTCCTAGGGACCATCAC CACCCTGGCAAAAACAGAAGGATTGCCGAAACTGTACAGCGGTCTGCCTGCGGGCATTCAGAGGCAAATC AGCTTTGCCTCACTCAGGATTGGCCTCTACGACTCAGTCCAAGAGTACTTCTCTTCAGGGAGAGAAACAC CTGCCTCTCTCGGAAACAAGATCTCAGCCGGCTTAATGACTGGAGGTGTGGCAGTGTTCATTGGGCAGCC TACAGAGGTCGTGAAGGTCAGAATGCAAGCCCAGAGCCATCTGCATGGGATCAAACCCCGCTACACGGGG ACCTACAATGCTTACAGAGTTATAGCCACCACAGAAAGCTTGTCAACACTTTGGAAAGGGACGACCCCTA ATCTAATGAGAAATGTCATCATCAATTGTACAGAGCTGGTAACATATGACCTCATGAAGGGGGCCCTTGT AAACAACAAAATACTGGCAGATGACGTCCCCTGCCATTTACTGTCAGCTCTTGTTGCCGGGTTTTGCACC ACACTCCTGGCCTCTCCAGTGGATGTGGTAAAAACAAGATTCATCAACTCTCTGCCAGGACAGTACCCAA GCGTACCAAGCTGTGCGATGTCCATGTACACCAAGGAAGGACCGACGGCCTTTTTCAAAGGGTTTGTGGC TTCTTTTCTGCGACTCGGGTCCTGGAACGTCATCATGTTTGTGTGCTTTGAACAGCTGAAAAAAGAGCTG ATGAAGTCCAGACAGACAGTGGATTGTACCACATAAGCAACTTGGAGGAAGAGATACTGAACATCATTGG GCTTCTATGCTGGGAGACCACGAATAAAACCAACCAAAGAAATCAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009463 |
| Insert Size | 924 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012701, AAH12701 |
| RefSeq Size | 1249 bp |
| RefSeq ORF | 924 bp |
| Locus ID | 22227 |
| UniProt ID | P12242 |
| Gene Summary | Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance (PubMed:9139827, PubMed:19187776, PubMed:23063128, PubMed:27027295). Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP (PubMed:23063128). Regulates the production of reactive oxygen species/ROS by mitochondria (PubMed:20416274, PubMed:20466728).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204339 | Ucp1 (tGFP-tagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1) |
CNY 4000.00 |
|
| MR204339 | Ucp1 (Myc-DDK-tagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
|
| MR204339L3 | Lenti ORF clone of Ucp1 (Myc-DDK-tagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1), nuclear gene encoding mitochondrial protein |
CNY 4750.00 |
|
| MR204339L4 | Lenti ORF clone of Ucp1 (mGFP-tagged) - Mouse uncoupling protein 1 (mitochondrial, proton carrier) (Ucp1), nuclear gene encoding mitochondrial protein |
CNY 4800.00 |
