Sult2b1 (BC009813) Mouse Untagged Clone

CAT#: MC200924

Sult2b1 (untagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (cDNA clone MGC:13879 IMAGE:4039050), (10ug)



CNY 2000.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI326997; BB173635; ST2B1; SULT2B
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC009813
CCACGCGTCCGCTACCTCCTGCCCTGCCCGCCATGGACGGGCCGCAGCCCCGCGCCCTGTGGAGCTCGTC TGAGAAAAATGTTTCCGAAATGAGCTGGAATTTTGGAGGTGAATACTTCAGATACAAAGGTATCCCTTTT CCTGTCGGCATGTACTCACCGGAGAGCCTCAGTCTGGCTGAGAACACTAGCAACGTGCGGGACGACGACA TCTTCATTGTCACCTACCCCAAATCAGGTACCAACTGGATGATTGAGATCGTCTGCTTAATCCTGAAAGA TGGGGATCCCTCGTGGATCCGATCGGAGCCCATCTGGCAACGTGCGCCCTGGTGCGAGACCATCATAAGC GCCTTCAATGTCTTAGACCGGCCCAGCCCCCGCATTATGAGCTCTCACCTCCCTATTGAACTCTTCACGA AGGCATTCTTCAGCTCCAAGGCTAAGGTGATTTACGTGGGCCGGAACCCCCGCGATGTCGTGGTCTCCCT CTATTATTATTCTAAGATTGCTGGGCAATTAAAGGACCCTGGTACACCCGACCAGTTCCTTCAAAATTTC CTCAAAGGAGAAGTGCAGTTTGGCTCCTGGTTTGACCACATCAAGGGCTGGATCCGGATGCAGAACCAAG AGAACTTCCTGTTTATCACCTATGAGGAGCTGCAGCAGGACCTGCGAGGCTCCGTGCAACGCATCTGTGA GTTCCTGGGCCGGCCACTGGGTGAAGAGGCCCTGAGCTCTGTGGTGGCCCACTCAGCCTTTGCTGCCATG AAGGCCAATACCATGTCCAACTACTCGCTGCTGCCGGCCAGCCTGCTGGACCACCGCCAGGGGGAGTTCC TGCGCAAAGGGATCAGTGGCGACTGGAAGAACCACTTCACTGTGGCCCAGAGTGAGGCTTTTGACAGTGT TTACCGAGAGCAAATGCACGGGGTGCAGAGGTTCCCCTGGGACACGTCTGAAGAGGATAGCAGCCCTGAT GGCCAGCCTGACCCTGAGCCCAGCCCCAGCCCAGCTTCTGATGACCCCAACCCAGGATCCTCACAATAAA CTTATCACTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC009813
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC009813, AAH09813
RefSeq Size 1094 bp
RefSeq ORF 1017 bp
Locus ID 54200
Gene Summary Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates hydroxysteroids such as dehydroepiandrosterone. Isoform 1 is required for production of cholesterol sulfate essential for normal skin development whereas isoform 2 produces pregnenolone sulfate, an essential neurosteroid during development of the central nervous system. Plays a role in epidermal cholesterol metabolism and in the regulation of epidermal proliferation and differentiation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...