Serpinb1a (NM_025429) Mouse Untagged Clone
CAT#: MC201136
Serpinb1a (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a), (10ug)
CNY 3656.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1190005M04Rik; AI325983; EI; EIA; ELANH2; LEI; M/NEI; MNEI; PI2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011140 sequence for NM_025429
GAGCCAGACCTGCTAAGCAAGAGACTTCACCATGGAGCAGCTGAGTTCAGCCAACACACTCTTCGCCTTG GAGCTGTTCCAAACCCTGAATGAAAGCAGCCCCACAGGAAACATCTTCTTCTCTCCCTTCAGCATTTCTT CTGCCTTGGCCATGGTCATTCTGGGGGCCAAAGGCAGCACTGCAGCTCAGCTTTCTAAGACTTTTCATTT TGACTCTGTTGAGGACATCCATTCACGCTTCCAAAGCCTGAATGCTGAAGTGAGCAAACGTGGAGCATCT CACACTCTGAAACTTGCTAACAGACTGTATGGAGAGAAAACCTACAACTTCCTTCCTGAATACTTGGCTT CAACCCAGAAAATGTATGGTGCTGACTTGGCCCCTGTGGATTTTCTGCATGCCTCCGAGGATGCAAGGAA GGAGATAAACCAGTGGGTCAAAGGTCAAACAGAAGGGAAAATCCCAGAACTGTTGTCTGTGGGTGTGGTG GACAGTATGACCAAACTTGTGCTGGTGAATGCCATCTACTTTAAGGGAATGTGGGAGGAGAAATTCATGA CAGAGGACACAACGGATGCTCCATTCCGACTGAGTAAGAAAGACACAAAAACAGTGAAGATGATGTATCA AAAGAAAAAATTTCCATTTGGTTACATTTCGGACCTGAAGTGCAAGGTGCTGGAGATGCCTTACCAGGGT GGAGAACTTAGCATGGTCATTCTGCTGCCTAAAGACATTGAGGACGAGTCCACGGGTCTTAAGAAGATTG AAAAGCAAATAACTTTGGAAAAACTGCTTGAATGGACCAAACGTGAGAACTTGGAATTCATTGATGTCCA CGTCAAACTGCCCCGGTTCAAGATAGAAGAGAGCTATACCCTCAACTCTAACCTGGGCCGCCTGGGAGTG CAGGATCTCTTTAGCAGTAGCAAGGCTGATCTCTCTGGCATGTCAGGATCCAGAGATCTTTTCATATCAA AAATTGTCCACAAGTCCTTTGTGGAAGTGAATGAGGAAGGAACAGAGGCAGCCGCTGCTACAGGAGGCAT TGCTACATTCTGTATGTTGTTGCCTGAGGAAGAATTCACAGTGGACCATCCGTTCATTTTCTTCATTCGG CACAATCCCACATCTAATGTGCTCTTCCTTGGCAGGGTTTGTTCCCCATAGAAGAAGGAGACTTTACAGA TACAAGGCAGAGCTTAGAGTTTCATTCCCTGAGATTTTAATAGTGATTATTTTCATTTGTACTTGACAAT AAAAACTCTAACCAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025429 |
| Insert Size | 1140 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011140, AAH11140 |
| RefSeq Size | 1294 bp |
| RefSeq ORF | 1140 bp |
| Locus ID | 66222 |
| UniProt ID | Q9D154 |
| Gene Summary | Neutrophil serine protease inhibitor that plays an essential role in the regulation of the innate immune response, inflammation and cellular homeostasis (PubMed:17664292, PubMed:21683252, PubMed:21248149, PubMed:30692621). Acts primarily to protect the cell from proteases released in the cytoplasm during stress or infection (PubMed:17664292). These proteases are important in killing microbes but when released from granules, these potent enzymes also destroy host proteins and contribute to mortality. Regulates the activity of the neutrophil proteases elastase, cathepsin G, proteinase-3, chymase, chymotrypsin, and kallikrein-3. Acts also as a potent intracellular inhibitor of granzyme H (PubMed:12189154). During inflammation, limits the activity of inflammatory caspases CASP1 and CASP4 by suppressing their caspase-recruitment domain (CARD) oligomerization and enzymatic activation (PubMed:30692621). In addition, promotes the proliferation of beta-cells when secreted (PubMed:26701651).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG205910 | Serpinb1a (tGFP-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a) |
CNY 3710.00 |
|
| MR205910 | Serpinb1a (Myc-DDK-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a) |
CNY 3656.00 |
|
| MR205910L3 | Lenti ORF clone of Serpinb1a (Myc-DDK-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a) |
CNY 5230.00 |
|
| MR205910L4 | Lenti ORF clone of Serpinb1a (mGFP-tagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a) |
CNY 5230.00 |
其它Serpinb1a产品
