Serpinb1a (NM_025429) Mouse Untagged Clone

CAT#: MC201136

Serpinb1a (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade B, member 1a (Serpinb1a), (10ug)



  "NM_025429" in other vectors (4)

CNY 3656.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
SERPINB1A Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1190005M04Rik; AI325983; EI; EIA; ELANH2; LEI; M/NEI; MNEI; PI2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011140 sequence for NM_025429
GAGCCAGACCTGCTAAGCAAGAGACTTCACCATGGAGCAGCTGAGTTCAGCCAACACACTCTTCGCCTTG GAGCTGTTCCAAACCCTGAATGAAAGCAGCCCCACAGGAAACATCTTCTTCTCTCCCTTCAGCATTTCTT CTGCCTTGGCCATGGTCATTCTGGGGGCCAAAGGCAGCACTGCAGCTCAGCTTTCTAAGACTTTTCATTT TGACTCTGTTGAGGACATCCATTCACGCTTCCAAAGCCTGAATGCTGAAGTGAGCAAACGTGGAGCATCT CACACTCTGAAACTTGCTAACAGACTGTATGGAGAGAAAACCTACAACTTCCTTCCTGAATACTTGGCTT CAACCCAGAAAATGTATGGTGCTGACTTGGCCCCTGTGGATTTTCTGCATGCCTCCGAGGATGCAAGGAA GGAGATAAACCAGTGGGTCAAAGGTCAAACAGAAGGGAAAATCCCAGAACTGTTGTCTGTGGGTGTGGTG GACAGTATGACCAAACTTGTGCTGGTGAATGCCATCTACTTTAAGGGAATGTGGGAGGAGAAATTCATGA CAGAGGACACAACGGATGCTCCATTCCGACTGAGTAAGAAAGACACAAAAACAGTGAAGATGATGTATCA AAAGAAAAAATTTCCATTTGGTTACATTTCGGACCTGAAGTGCAAGGTGCTGGAGATGCCTTACCAGGGT GGAGAACTTAGCATGGTCATTCTGCTGCCTAAAGACATTGAGGACGAGTCCACGGGTCTTAAGAAGATTG AAAAGCAAATAACTTTGGAAAAACTGCTTGAATGGACCAAACGTGAGAACTTGGAATTCATTGATGTCCA CGTCAAACTGCCCCGGTTCAAGATAGAAGAGAGCTATACCCTCAACTCTAACCTGGGCCGCCTGGGAGTG CAGGATCTCTTTAGCAGTAGCAAGGCTGATCTCTCTGGCATGTCAGGATCCAGAGATCTTTTCATATCAA AAATTGTCCACAAGTCCTTTGTGGAAGTGAATGAGGAAGGAACAGAGGCAGCCGCTGCTACAGGAGGCAT TGCTACATTCTGTATGTTGTTGCCTGAGGAAGAATTCACAGTGGACCATCCGTTCATTTTCTTCATTCGG CACAATCCCACATCTAATGTGCTCTTCCTTGGCAGGGTTTGTTCCCCATAGAAGAAGGAGACTTTACAGA TACAAGGCAGAGCTTAGAGTTTCATTCCCTGAGATTTTAATAGTGATTATTTTCATTTGTACTTGACAAT AAAAACTCTAACCAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025429
Insert Size 1140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011140, AAH11140
RefSeq Size 1294 bp
RefSeq ORF 1140 bp
Locus ID 66222
UniProt ID Q9D154
Gene Summary Neutrophil serine protease inhibitor that plays an essential role in the regulation of the innate immune response, inflammation and cellular homeostasis (PubMed:17664292, PubMed:21683252, PubMed:21248149, PubMed:30692621). Acts primarily to protect the cell from proteases released in the cytoplasm during stress or infection (PubMed:17664292). These proteases are important in killing microbes but when released from granules, these potent enzymes also destroy host proteins and contribute to mortality. Regulates the activity of the neutrophil proteases elastase, cathepsin G, proteinase-3, chymase, chymotrypsin, and kallikrein-3. Acts also as a potent intracellular inhibitor of granzyme H (PubMed:12189154). During inflammation, limits the activity of inflammatory caspases CASP1 and CASP4 by suppressing their caspase-recruitment domain (CARD) oligomerization and enzymatic activation (PubMed:30692621). In addition, promotes the proliferation of beta-cells when secreted (PubMed:26701651).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...