Fbxo6 (NM_015797) Mouse Untagged Clone

CAT#: MC201276

Fbxo6 (untagged) - Mouse F-box protein 6 (Fbxo6), transcript variant 1, (10ug)



  "NM_015797" in other vectors (5)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA408845; FBG2; Fbs2; Fbx6b; Fbxo6b
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC017512 sequence for NM_015797
GAGTCCGGCGCCGGGACGCGGGGACGCCGGGCCTGCTGTAGGCACGCGAGGGTCCCGGACGGTGGCGACA CCGGCTTCTCCTTGGGACGCCGGGCTTCAGGCGCTAGGGTCTGGGAACGTAATTCTCTGTTGCCACCATG GTCCACATCAACGAGCTGCCAGAGAACATTCTCCTGGAGCTGTTCATCCATATCCCGGCCCCACAGCTGC TGCGCAACTGCCGCCTGGTCTGCCGCCTCTGGCGAGACCTCATCGATGTGGTGTCCCTATGGAAGCGCAA GAGTCTTCGAGAGGGCTTCTTCACCAAAGACCGGTGCGAGCCCGTGGAAGACTGGAAGGTCTTCTATATC CTGTGCAGCCTGCAGAGGAACCTCCTTCGGAACCCGTGTGCTGAAGAGAACCTGAGCTCATGGCGGATAG ACTCCAACGGAGGGGATCGCTGGAAGGTGGAGACGCTCCCTGGGAGCTGTGGCACAAGCTTTCCTGACAA CAAGGTCAAGAAGTATTTTGTCACCTCTTTTGAGATGTGCCTCAAATCCCAGATGGTGGACCTCAAAGCT GAGGGCTACTGCGAGGAGCTGATGGACACCTTTCGGCCTGACATTGTGGTTAAGGACTGGGTTGCCCCCA GAGCAGACTGTGGCTGCACCTATCAACTCCGGGTACAGCTGGCCTCTGCGGACTACATTGTCTTGGCCTC TTTTGAGCCTCCACCTGTGACATTCCAACAGTGGAATGATGCCAAATGGCAAGAGATTTCCCACACCTTC TCTGATTACCCTCCAGGTGTCCGTCACATCCTTTTTCAACACGGGGGCCAGGACACTCAGTTCTGGAAAG GCTGGTACGGCCCCCGTGTCACCAACAGCAGCATCATTATCAGCCACAGGACAGCCAAGAACCCTCCCCC TGCCAGAACTCTACCGGAAGAAACTGTAGTAATCGGAAGGAGACGGCGAGCTTCGGACTCCAACACTCAT GAGGGTTTCTTCTGGCAAGGGCTATGGCAAAGGCTAAGGCGTTAGTGGGCAGTCAGGCTCCCAGTCCCAT GAGCACTTGCCCTATACAACCTTGGGCAAGCCCATCAACTCAGTAGTGATAGTTGGCACCCACAGCTCTG ACATTTTGTTGTAATAAATGTTTTCAGTAACCCAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_015797
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC017512, AAH17512
RefSeq Size 1175 bp
RefSeq ORF 888 bp
Locus ID 50762
UniProt ID Q9QZN4
Gene Summary Substrate-recognition component of some SCF (SKP1-CUL1-F-box protein)-type E3 ubiquitin ligase complexes. Involved in DNA damage response by specifically recognizing activated CHEK1 (phosphorylated on 'Ser-345'), promoting its ubiquitination and degradation. Ubiquitination of CHEK1 is required to insure that activated CHEK1 does not accumulate as cells progress through S phase, or when replication forks encounter transient impediments during normal DNA replication (By similarity). Involved in endoplasmic reticulum-associated degradation pathway (ERAD) for misfolded lumenal proteins by recognizing and binding sugar chains on unfolded glycoproteins that are retrotranslocated into the cytosol and promoting their ubiquitination and subsequent degradation. Able to recognize and bind denatured glycoproteins, which are modified with not only high-mannose but also complex-type oligosaccharides. Also recognizes sulfated glycans.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1-6 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...