Prdx4 (NM_016764) Mouse Untagged Clone
CAT#: MC201312
Prdx4 (untagged) - Mouse peroxiredoxin 4 (Prdx4), (10ug)
CNY 3600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AOE372; Prx-iv; Prx4; TRANK |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC019578 sequence for NM_016764
CCCACGCGTCCGGTCGCGCGGTCTCCAGCGCGCCGTTTTAGCTGGCTGCCTGGCGGCAGGGGACTCTGTG CTTTAGCAGAGGGACGTGTTTTCGCGCTTGCTTGGTCATGGAGGCGCGGTCCAAGCTGCTGGACGGGACC ACGGCGTCCCGTCGCTGGACCCGAAAGCTGGTGTTGCTCCTGCCGCCGCTGCTGCTGTTCCTGTTGCGGA CCGAATCTCTGCAAGGCTTGGAGAGTGATGAACGGTTCCGGACCCGCGAAAATGAGTGCCACTTCTACGC TGGTGGACAAGTGTACCCCGGGGAGGCGTCCCGGGTTTCAGTCGCGGATCACTCCCTGCATCTAAGCAAA GCCAAGATCTCCAAGCCAGCACCTTATTGGGAAGGAACAGCTGTGATTAACGGAGAATTCAAGGAGCTCA AACTGACTGACTATCGTGGGAAATACTTGGTTTTTTTCTTCTACCCACTGGATTTCACCTTTGTGTGTCC AACTGAAATCATCGCTTTTGGGGATCGAATTGAAGAATTCAAATCTATAAATACTGAAGTGGTAGCATGC TCTGTTGACTCTCAGTTTACCCACTTGGCCTGGATTAATACCCCTCGAAGACAAGGAGGACTGGGGCCAA TAAGGATTCCACTTCTTTCTGACCTGAACCATCAGATCTCAAAGGACTATGGTGTATACCTTGAAGACTC AGGACATACTCTTAGAGGCCTCTTTATTATCGATGACAAAGGAGTCCTGAGGCAGATTACTCTGAATGAC CTTCCTGTCGGAAGATCAGTGGACGAGACACTGCGTTTGGTTCAAGCCTTCCAGTACACTGACAAGCATG GAGAAGTCTGCCCTGCTGGCTGGAAACCTGGTAGTGAAACAATAATCCCAGATCCAGCTGGAAAACTGAA GTATTTCGACAAGCTAAACTGAAAAGTACTTCAGTTATGATGTTTGGACCTTCTCAATAAAGGTCATTGT GTTATTACCATAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_016764 |
| Insert Size | 825 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC019578, AAH19578 |
| RefSeq Size | 1004 bp |
| RefSeq ORF | 825 bp |
| Locus ID | 53381 |
| UniProt ID | O08807 |
| Gene Summary | Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively. Plays a role in cell protection against oxidative stress by detoxifying peroxides and as sensor of hydrogen peroxide-mediated signaling events (PubMed:11229364). Regulates the activation of NF-kappa-B in the cytosol by a modulation of I-kappa-B-alpha phosphorylation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks contains an alternate exon in the 3' coding region compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Oxidation of peroxiredoxin-4 induces oligomerization and promotes interaction with proteins governing protein folding and endoplasmic reticulum stress
,Elko, EA;Manuel, AM;White, S;Zito, E;van der Vliet, A;Anathy, V;Janssen-Heininger, YMW;,
The Journal of biological chemistry
,PubMed ID 33895140
[PRDX4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203677 | Prdx4 (tGFP-tagged) - Mouse peroxiredoxin 4 (Prdx4) |
CNY 5200.00 |
|
| MR203677 | Prdx4 (Myc-DDK-tagged) - Mouse peroxiredoxin 4 (Prdx4) |
CNY 3600.00 |
|
| MR203677L3 | Lenti ORF clone of Prdx4 (Myc-DDK-tagged) - Mouse peroxiredoxin 4 (Prdx4) |
CNY 5890.00 |
|
| MR203677L4 | Lenti ORF clone of Prdx4 (mGFP-tagged) - Mouse peroxiredoxin 4 (Prdx4) |
CNY 5890.00 |
