Calca (NM_007587) Mouse Untagged Clone
CAT#: MC201376
Calca (untagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1, (10ug)
CNY 1200.00
CNY 2000.00
Product images
                    
                CNY 9600.00
Specifications
| Product Data | |
| Type | Mouse Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | C; CA; Calc; Calc1; Cg; Cgrp; CGRP-1; CGRP1; Ct; Ctn | 
| Vector | PCMV6-Kan/Neo | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >BC030071 sequence for NM_007587 
AAGAGTCACCGCTTCGCAAGCACTGCCTGGCTCCATCAGGATCCCCGCAGGCTCAGCTCCAAGGCACCGC TCACCAGGAAGGCATCATGGGCTTCCTGAAGTTCTCCCCTTTCCTGGTTGTCAGCATCTTGCTCCTGTAC CAGGCATGCAGCCTCCAGGCAGTGCCTTTGAGGTCAATCTTGGAAAGCAGCCCAGGCATGGCCACTCTCA GTGAAGAAGAAGTTCGCCTGCTGGCTGCACTGGTGCAGGACTATATGCAGATGAAAGCCAGGGAGCTGGA GCAGGAGGAAGAGCAGGAGGCTGAGGGCTCTAGCTTGGACAGCCCCAGATCTAAGCGGTGTGGGAATCTG AGTACCTGCATGCTGGGCACGTACACACAAGACCTCAACAAGTTTCACACCTTCCCCAAAACTTCAATTG GGGTTGAAGCACCTGGCAAGAAAAGGGATGTGGCCAAGGACTTGGAGACAAACCACCAATCCCATTTTGG CAACTAAGCTCCTTCTCTCCTTTCTAGTTTCCTTCTTGCTTTCTTCCTATAACTTGATGCATGTAGTTCC TCTCTGGTTGCTCTCCAGGCTATTACTGGTTGCTTTCCTGAGGCAAAGAATGGTATCTGAAATCCCCAGT GGGTGAGGAGAAAGTCCCACAGGCTAAAAGAGAATCACCCAGGAAGATGGCAGAGAGCAAGGGCACACTC AGGAAGATGGCAGAGAGCAAGGGCAGTCATCTGGCTTCCTAGTAGAGCTTCTAGTCTTGCTTCTGGAAGT GTTGGTTGTTTGGGAAATAAAACTATTTTTTAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA  | 
        
| Restriction Sites | EcoRI-NotI | 
| ACCN | NM_007587 | 
| Insert Size | 411 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | BC030071, AAH30071 | 
| RefSeq Size | 857 bp | 
| RefSeq ORF | 411 bp | 
| Locus ID | 12310 | 
| UniProt ID | P70160 | 
| Gene Summary | This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide (CGRP) and katacalcin. Alternative splicing of the mRNA results in multiple variants that encode either calcitonin or CGRP preproproteins. Post-translational processing of the calcitonin and CGRP propeptides results in either calcitonin and katacalcin, or CGRP, respectively. Calcitonin and katacalcin modulate calcium levels in the blood stream. CGRP can function as a vasodilator and play a role in the transmission of pain. The human homolog of CGRP was found to have antimicrobial activity. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (1) encodes the longer isoform (Calca). Both variants 1 and 4 encode the same protein.  | 
        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| MG200827 | Calca (tGFP-tagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1 | 
                                                     CNY 2090.00  | 
                                            |
| MR200827 | Calca (Myc-DDK-tagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| MR200827L3 | Lenti ORF clone of Calca (Myc-DDK-tagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1 | 
                                                     CNY 3800.00  | 
                                            |
| MR200827L4 | Lenti ORF clone of Calca (mGFP-tagged) - Mouse calcitonin/calcitonin-related polypeptide, alpha (Calca), transcript variant 1 | 
                                                     CNY 3800.00  | 
                                            
