United States
Germany
Japan
United Kingdom
China
Slpi (NM_011414) Mouse Untagged Clone
CAT＃: MC201386
Slpi (untagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC028509 sequence for NM_011414
GCTTCTGTCATTTTCAGCTCTCAGGTGGTTACTCTGATGGCCTCATGGTCCTGCCTGAAACAGAAAGTCT GCCACCTACTTCTGTAGCAGCAAGACTCCTGTTCTGTGGCTAAGCTTCCTGCCTGTGCAAGAGCCACAGG GAGGGGCCAAATGCATGCCACTGGGGCCACGCCTCCTGGTAAAGACATAAATAGTGATCCTCGGGACTGG TCATCAGAGCTCCCCTGCCTTCACCATGAAGTCCTGCGGCCTTTTACCTTTCACGGTGCTCCTTGCTCTG GGGATCCTGGCACCCTGGACTGTGGAAGGAGGCAAAAATGATGCTATCAAAATCGGAGCCTGCCCTGCTA AAAAGCCTGCCCAGTGCCTTAAGCTTGAGAAGCCACAATGCCGTACTGACTGGGAGTGCCCGGGAAAGCA GAGGTGCTGCCAAGATGCTTGCGGTTCCAAGTGCGTGAATCCTGTTCCCATTCGCAAACCAGTGTGGAGG AAGCCTGGGAGGTGCGTCAAAACTCAGGCAAGATGTATGATGCTTAACCCTCCCAATGTCTGCCAGAGGG ACGGGCAGTGTGACGGCAAATACAAGTGCTGTGAGGGTATATGTGGGAAAGTCTGCCTGCCCCCGATGTG AGCCTGATCCCTGACATTGGCGCCGGCTCTGGACTCGTGCTCGGTGTGCTCTGGAAACTACTTCCCTGCT CCCAGGCGTCCCTGCTCCGGGTTCCATGGCTCCCGGCTCCCTGTATCCCAGGCTTGGATCCTGTGGACCA GGGTTACTGTTTTACCACTAACATCTCCTTTTGGCTCAGCATTCACCGATCTTTAGGGAAATGCTGTTGG AGAGCAAATAAATAAACGCATTCATTTCTCTATGCAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_011414 |
| Insert Size | 396 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC028509, AAH28509 |
| RefSeq Size | 894 bp |
| RefSeq ORF | 396 bp |
| Locus ID | 20568 |
| UniProt ID | P97430 |
| Gene Summary | Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G (PubMed:9126337). Modulates the innate immune response after bacterial infection (PubMed:12615907). Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major (PubMed:25030421). Down-regulates responses to bacterial lipopolysaccharide (LPS) (PubMed:9039268, PubMed:12615907, PubMed:25030421). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses (PubMed:11017147, PubMed:12615907). Has antimicrobial activity against mycobacteria, but not against salmonella (PubMed:18322212). Contributes to normal resistance against infection by M.tuberculosis (PubMed:18322212). Required for normal resistance to L.major (PubMed:25030421). Required for normal wound healing, probably by preventing tissue damage by limiting protease activity (PubMed:11017147, PubMed:25030421). Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200750 | Slpi (tGFP-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) |
CNY 2,800.00 |
|
| MR200750 | Slpi (Myc-DDK-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) |
CNY 1,200.00 |
|
| MR200750L3 | Lenti ORF clone of Slpi (Myc-DDK-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) |
CNY 3,600.00 |
|
| MR200750L4 | Lenti ORF clone of Slpi (mGFP-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) |
CNY 3,600.00 |
