Pla2g2e (NM_012044) Mouse Untagged Clone
CAT#: MC201400
Pla2g2e (untagged) - Mouse phospholipase A2, group IIE (Pla2g2e), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027524 sequence for NM_012044
CTCACTTCCTCCCATTGCAGCAGGCTCCCATGCCCCCTGCCTACCTCCCCCAGGATGAAACCTCCCATTG CCCTGGCTTGCCTTTGCCTCCTGGTGCCCCTGGCTGGCGGGAACCTGGTCCAGTTTGGAGTGATGATTGA GAGAATGACGGGAAAGCCTGCCCTGCAGTACAATGACTATGGCTGCTATTGCGGTGTCGGTGGCTCCCAC TGGCCAGTGGACGAGACGGATTGGTGTTGTCATGCCCATGACTGCTGCTATGGCCGCCTGGAGAAGCTGG GCTGTGACCCCAAGCTGGAAAAGTACCTCTTCTCTATCACTCGAGACAACATCTTCTGTGCTGGTAGAAC GGCTTGCCAGCGGCATACCTGCGAGTGTGACAAGAGAGCTGCTCTTTGCTTTCGCCACAACCTGAACACT TACAACCGCAAGTATGCCCACTACCCCAACAAGCTGTGTACTGGGCCCACCCCACCCTGCTGAGGCCCTG CTCGGCTCCATAGCCACCCCAGGCTGCTGCAGTCCCAGGCCCAGAGAAGCTCGGAACCCAGATTCCTCTC CCAGCAGACTCATCCCGCCCCCCCCCCCAGAGATCATGAGCCCTGGTCTCTGGCCTCCAGGACCACACCA GATCCACGGGATCAGCTGAAGAAGTCACGGGACTCGTCAGCGCTCACAAGATCCACTAAGTCGCCTCTGG CATCTCAATACCCTCTTCTGAATAAGAGAAGTCTATTTTCCTGTAAAAAAAAAAAAAAAAAA |
Restriction Sites | EcoRI-NotI |
ACCN | NM_012044 |
Insert Size | 429 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC027524, AAH27524 |
RefSeq Size | 762 bp |
RefSeq ORF | 429 bp |
Locus ID | 26970 |
UniProt ID | Q9QUL3 |
Gene Summary | PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200923 | Pla2g2e (tGFP-tagged) - Mouse phospholipase A2, group IIE (Pla2g2e) |
CNY 2850.00 |
|
MR200923 | Pla2g2e (Myc-DDK-tagged) - Mouse phospholipase A2, group IIE (Pla2g2e) |
CNY 1200.00 |
|
MR200923L3 | Lenti ORF clone of Pla2g2e (Myc-DDK-tagged) - Mouse phospholipase A2, group IIE (Pla2g2e) |
CNY 4750.00 |
|
MR200923L4 | Lenti ORF clone of Pla2g2e (mGFP-tagged) - Mouse phospholipase A2, group IIE (Pla2g2e) |
CNY 4750.00 |
其它Pla2g2e产品