Tnnc2 (NM_009394) Mouse Untagged Clone
CAT#: MC201847
Tnnc2 (untagged) - Mouse troponin C2, fast (Tnnc2), (10ug)
CNY 1200.00
CNY 2000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Tncs |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC024390 sequence for NM_009394
CGGACGCGTGGGGTGGTGGAGTGCGGAGGAGACAACCCACAGCGGAGGAGTCCCAGTCGCCAGCAACCAT GACGGACCAACAGGCTGAGGCCAGGTCCTACCTCAGCGAGGAGATGATCGCTGAGTTCAAGGCTGCCTTT GACATGTTCGATGCTGATGGCGGTGGGGACATCAGCGTTAAAGAGTTGGGCACCGTGATGAGGATGCTAG GGCAGACACCCACCAAAGAGGAATTGGATGCCATCATCGAGGAGGTGGACGAGGATGGCAGCGGTACTAT CGACTTTGAAGAGTTCTTGGTCATGATGGTGCGCCAGATGAAAGAGGATGCGAAGGGGAAGAGCGAAGAG GAACTGGCTGAGTGCTTCCGCATCTTTGACAGGAACGCAGACGGCTACATTGATGCTGAGGAGCTAGCTG AGATTTTCCGGGCTTCTGGGGAGCATGTGACAGAAGAGGAGATCGAATCCCTGATGAAGGATGGTGATAA AAACAACGACGGCCGCATTGACTTTGATGAGTTTCTGAAGATGATGGAGGGCGTTCAGTAAGGAGACGGT CTTTGTTCGTGTCCATCCAGACTGCAGGTCCCCTGGGCGTGGGCAGCTCCACCTTTGCTTTCCCTGCCTC ACACGGGAAAGGCTGCTCCTTTGGGCTCTGTGACTGGAAGGAATAAAAGTTGACAATGTAAAAAAAAAAA AAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_009394 |
| Insert Size | 483 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC024390, AAH24390 |
| RefSeq Size | 704 bp |
| RefSeq ORF | 483 bp |
| Locus ID | 21925 |
| UniProt ID | P20801 |
| Gene Summary | Troponin is the central regulatory protein of striated muscle contraction. Tn consists of three components: Tn-I which is the inhibitor of actomyosin ATPase, Tn-T which contains the binding site for tropomyosin and Tn-C. The binding of calcium to Tn-C abolishes the inhibitory action of Tn on actin filaments.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201248 | Tnnc2 (tGFP-tagged) - Mouse troponin C2, fast (Tnnc2) |
CNY 2850.00 |
|
| MR201248 | Tnnc2 (Myc-DDK-tagged) - Mouse troponin C2, fast (Tnnc2) |
CNY 1200.00 |
|
| MR201248L3 | Lenti ORF clone of Tnnc2 (Myc-DDK-tagged) - Mouse troponin C2, fast (Tnnc2) |
CNY 4750.00 |
|
| MR201248L4 | Lenti ORF clone of Tnnc2 (mGFP-tagged) - Mouse troponin C2, fast (Tnnc2) |
CNY 4750.00 |
