Hspe1 (NM_008303) Mouse Untagged Clone

CAT#: MC201854

Hspe1 (untagged) - Mouse heat shock protein 1 (chaperonin 10) (Hspe1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_008303" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 10kDa; Hsp10; mt-cpn10
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024385 sequence for NM_008303
GTGGCGGCGAAGGCGAGAGTCATGGCTGGACAAGCTTTTAGGAAGTTTCTTCCGCTCTTTGACAGAGTAT TGGTTGAAAGGAGTGCTGCCGAAACTGTAACCAAAGGTGGCATTATGCTTCCAGAAAAGTCTCAAGGAAA AGTGTTGCAAGCAACGGTCGTGGCTGTGGGGTCAGGAGGGAAAGGAAAGAGTGGAGAGATTGAGCCTGTC AGTGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGG ATTATTTCTTATTTAGAGATAGTGACATTCTTGGAAAGTATGTCGACTGAAATCACTGTTGAAATGGTGT CACGTGAAGCTGCCATTCCACTGATGTCTGAACTATTTCATCATGTAAATAATTTCCATGCCTCCCTTTT ATAATAAACAGATGATGCCTAAACTGACAGCCATTGTCTCTGACCTTTAGTTTCACTGTACTGTTACAAA CATTTCCAAATAAAATGATGTAAATGAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008303
Insert Size 309 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC024385, AAH24385
RefSeq Size 534 bp
RefSeq ORF 309 bp
Locus ID 15528
UniProt ID Q64433
Gene Summary Co-chaperonin implicated in mitochondrial protein import and macromolecular assembly. Together with Hsp60, facilitates the correct folding of imported proteins. May also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. The functional units of these chaperonins consist of heptameric rings of the large subunit Hsp60, which function as a back-to-back double ring. In a cyclic reaction, Hsp60 ring complexes bind one unfolded substrate protein per ring, followed by the binding of ATP and association with 2 heptameric rings of the co-chaperonin Hsp10. This leads to sequestration of the substrate protein in the inner cavity of Hsp60 where, for a certain period of time, it can fold undisturbed by other cell components. Synchronous hydrolysis of ATP in all Hsp60 subunits results in the dissociation of the chaperonin rings and the release of ADP and the folded substrate protein.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...