Cited1 (NM_007709) Mouse Untagged Clone
CAT#: MC201997
Cited1 (untagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1), (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI316840; AU019144; Msg1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC052030 sequence for NM_007709
CCGGAGTCCGGGCGCCGGAGCTGCGGGCCGGCAAGAGCGCGGGTCGGGGCAGCTCGGCGCTGCCCGGTGC GGTGCGGCGGCGCGGCGCGGCGCGGCGGTGCAGGCTTTTCCCAGGCGCCCTGGGGTCGCGTGGCCGCCCG TGCGGCTGGGGACTCTGAAGCGAGTGGCTAGCGGCGGCGGCGGCAGTGTGCGTGCCAAGGGGGCTCGGGG CTAGGTCGCTTCGTCCGTACCTCAGCTCCTGTGAGCTTTCCTCTCCCGGGCAAGCAGCTTCGCGGAGACC AACAGGCCCAGCTGGCGGCATCAACTGCCACCGATTTATCGGACTTCTGCCCAGGCTCTGAAATGCCAAC TATGTCGAGGCCTGCACTTGATGTCAAGGGTGGCACCACCTCTGGGAAGGAGGATGCCAACCAGGAGATG AACTCTCTGGCCTACTCCAACCTTGGAGTGAAGGATCGCAAGGCAGTGACTGTCCTGCACTACCCCGGGG TCACCGCAAATGGAGCCAAAGCCAACGGAGTTCCCACTAGCTCCTCTGGATCGACATCTCCAATAGGCTC TCCTACTGCCACCCCTTCTTCCAAACCCCCATCCTTCAACCTGCATCCTACCCCTCACCTGATGGCCAGC ATGCAGCTTCAGAAGCTTAATAGCCAGTACCAAGGGGCTGCGGCTACTGCTGCTGCTGCCCTCACTGGTG CAGGCCTACCAGGGGAGGAAGAGCCCATGCAAAACTGGGTCACCGCCCCTCTGGTAGTGGGAGGGTCTCC GGGATCTGTCTCTCCTCCTGCTGGTGCCCAGAGCCCTGCTCTCATTGATTCTGACCCGGTGGATGAGGAG GTGCTGATGTCTCTGGTGGTTGAATTGGGGCTAGACCGAGCCAATGAGCTTCCCGAGCTGTGGCTGGGGC AGAATGAGTTTGATTTCACTGCAGATTTTCCCTCTGGCTGCTGATGGCAAGTGCCCCTAAAAAAAAAAAA AAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_007709 |
Insert Size | 612 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC052030, AAH52030 |
RefSeq Size | 988 bp |
RefSeq ORF | 612 bp |
Locus ID | 12705 |
UniProt ID | P97769 |
Gene Summary | Transcriptional coactivator of the p300/CBP-mediated transcription complex. Enhances SMAD-mediated transcription by strengthening the functional link between the DNA-binding SMAD transcription factors and the p300/CBP transcription coactivator complex. Stimulates estrogen-dependent transactivation activity mediated by estrogen receptors signaling; stabilizes the interaction of estrogen receptor ESR1 and histone acetyltransferase EP300. Positively regulates TGF-beta signaling through its association with the SMAD/p300/CBP-mediated transcriptional coactivator complex. Induces transcription from estrogen-responsive promoters and protection against cell death. Potentiates EGR2-mediated transcriptional activation activity from the ERBB2 promoter. Acts as an inhibitor of osteoblastic mineralization through a cAMP-dependent parathyroid hormone receptor signaling. May play a role in pigmentation of melanocytes. Associates with chromatin to the estrogen-responsive TGF-alpha promoter region in a estrogen-dependent manner.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202100 | Cited1 (tGFP-tagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1) |
CNY 4000.00 |
|
MR202100 | Cited1 (Myc-DDK-tagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1) |
CNY 2400.00 |
|
MR202100L3 | Lenti ORF clone of Cited1 (Myc-DDK-tagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1) |
CNY 4750.00 |
|
MR202100L4 | Lenti ORF clone of Cited1 (mGFP-tagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1) |
CNY 4750.00 |