Timp1 (NM_011593) Mouse Untagged Clone
CAT#: MC202082
Timp1 (untagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 2, (10ug)
CNY 2400.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Clgi; EPA; Timp; TIMP-1; TPA-S1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC051260 sequence for NM_011593
AAGAGGTAATCCCGCAGATCGGGGCTCCTAGAGACACACCAGAGATACCATGATGGCCCCCTTTGCATCT CTGGCATCTGGCATCCTCTTGTTGCTATCACTGATAGCTTCCAGTAAGGCCTGTAGCTGTGCCCCACCCC ACCCACAGACAGCCTTCTGCAACTCGGACCTGGTCATAAGGGCTAAATTCATGGGTTCCCCAGAAATCAA CGAGACCACCTTATACCAGCGTTATAAGATCAAGATGACTAAGATGCTAAAAGGATTCAAGGCTGTGGGA AATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAAGCCTCTGTGGATATGCCCACAAGTCCC AGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAACGGAAATTTGCACATCAGTGCCTGCAG CTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGAGCTTTCTCAAAGACCTATAGTGCTGGC TGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCAAACTGGAGAGTGACACTCACTGTTTGT GGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCGTCACTTTGCTTGCCTGCCACGGAATCC AGGCTTGTGCACCTGGAGATCCCTTGGGGCCCGATGACCTGAAGCCTTCCCCCAGGAAAAACTGAAGCCT GAACACTGTCTACTTTTCCTCCATCTTTCTTTCTCTTAGATGGTGAAATAAAGAACTATCAGACAGCAAA AAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_011593 |
| Insert Size | 618 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC051260, AAH51260 |
| RefSeq Size | 780 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 21857 |
| UniProt ID | P12032 |
| Gene Summary | Metalloproteinase inhibitor that functions by forming one to one complexes with target metalloproteinases, such as collagenases, and irreversibly inactivates them by binding to their catalytic zinc cofactor. Acts on MMP1, MMP2, MMP3, MMP7, MMP8, MMP9, MMP10, MMP11, MMP12, MMP13 and MMP16. Does not act on MMP14 (By similarity). Also functions as a growth factor that regulates cell differentiation, migration and cell death and activates cellular signaling cascades via CD63 and ITGB1. Plays a role in integrin signaling.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (a). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Disruptions of occludin and claudin-5 in brain endothelial cells in vitro and in brains of mice with acute liver failure
,null,
Hepatology (Baltimore, Md.)
,PubMed ID 19821483
[Timp1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227162 | Timp1 (tGFP-tagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1) transcript variant 2, (10ug) |
CNY 2850.00 |
|
| MR227162 | Timp1 (Myc-DDK-tagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 2 |
CNY 2400.00 |
|
| MR227162L3 | Lenti ORF clone of Timp1 (Myc-DDK-tagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 2 |
CNY 4750.00 |
|
| MR227162L4 | Lenti ORF clone of Timp1 (mGFP-tagged) - Mouse tissue inhibitor of metalloproteinase 1 (Timp1), transcript variant 2 |
CNY 4800.00 |
