Aimp2 (NM_146165) Mouse Untagged Clone
CAT#: MC202134
Aimp2 (untagged) - Mouse aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 2, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA407136; AA407225; Aimp2(p38); Jtv1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024480 sequence for NM_146165
CCCACGCGTCCGGCCAGCAGCAGAGTCAGAAAGAAGGCGGCTGCTGTCTGAGGTGGCCTTGGGTGGCTTC TGAGCGTTCCTGTCCCTCGCCCGCTACCTTCCTTGGGTTCCCACCATGCCGATGTACCAGGAAACATCCG AGCCTTCTTTGCAAGCCCTTGAATCTCGCCAAGATGATATTTTAAAACGCTTGTATGAGTTGAAGGCAGC AGTCGATGGCCTTTCAAAGATGATTCACACCCCAGATGCAGACTTGGACGTAACCAACATCCTGCAAGCT GATGAGCCCACAACTTTAGCCACAAACACATTGGACTTGAATTCCGTGCTTGGAAAGGACTATGGGGCGC TGAAAGACATTGTGATCAACGCAAACCCAGCCTCCCCACCACTGTCCCTGCTTGTGCTGCACAGGCTGCT CTGTGAACGCTACAGGGTCCTGTCCACTGTGCACACACATTCGTCTGTCAAGAATGTGCCCGAGAATCTT GTCAAGTGCTTCGGGGAGCAGGCTAGGAAGCAGTCCCGCCACGAGTATCAGCTGGGCTTCACTCTGATTT GGAAGAATGTGCCCAAGACACAGATGAAGTTCAGTGTACAAACCATGTGCCCCATTGAAGGAGAAGGGAA CATCGCACGTTTCCTGTTCTCTCTGTTTGGCCAGAAGCATAATGCTGTCACCCTCACCCTCATCGATAGC TGGGTGGATATCGCCATGTTTCAGCTTCGAGAAGGCAGCAGTAAAGAAAAAGCGGCCGTGTTCCGCTCTA TGAACTCCGCTTTGGGGAGGAGCCCGTGGCTGGTTGGAAATGAGCTCACTGTGGCAGATGTGGTGCTGTG GTCTGTGCTCCAGCAGACTGGGGGCAGCAGTGGGGCAGCACCCACCAATGTGCAGCGGTGGCTTAAGTCC TGTGAAAACCTGGCCCCCTTCAGCACTGCCCTTCAGCTCCTTAAGTGAATTCGAGCAGCTTGTCTTGCAG GGTTCAACAGAAGAATGGTACGGCTTCCAGTCTGTTGTCAGAAAGGGACTTGTCCAATAAAGTACCATAT CATCTAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_146165 |
Insert Size | 843 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC024480, AAH24480 |
RefSeq Size | 1072 bp |
RefSeq ORF | 843 bp |
Locus ID | 231872 |
Gene Summary | Required for assembly and stability of the aminoacyl-tRNA synthase complex (PubMed:12060739). Mediates ubiquitination and degradation of FUBP1, a transcriptional activator of MYC, leading to MYC down-regulation which is required for aveolar type II cell differentiation (PubMed:12819782). Blocks MDM2-mediated ubiquitination and degradation of p53/TP53 (PubMed:18695251). Functions as a proapoptotic factor (PubMed:16135753).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. The resulting isoform (2) lacks an internal segment near the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203791 | Aimp2 (tGFP-tagged) - Mouse JTV1 gene (Jtv1) |
CNY 2850.00 |
|
MR203791 | Aimp2 (Myc-DDK-tagged) - Mouse aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 2 |
CNY 2400.00 |
|
MR203791L3 | Lenti ORF clone of Aimp2 (Myc-DDK-tagged) - Mouse aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 2 |
CNY 4750.00 |
|
MR203791L4 | Lenti ORF clone of Aimp2 (mGFP-tagged) - Mouse aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (Aimp2), transcript variant 2 |
CNY 4750.00 |