Dph3 (NM_172254) Mouse Untagged Clone
CAT#: MC202244
Dph3 (untagged) - Mouse DPH3 homolog (KTI11, S. cerevisiae) (Dph3), transcript variant 1, (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | DELGIP1; DelgipP1; Desr1; KTI11; Zcsl2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029910 sequence for NM_172254
GGAAGACCGGGCCTTACCCTGCCTGGGCGCAGGTAGGCAAGCTGATGCGGTGCCGACCGGGTGACCATGG CGGTGTTTCACGACGAGGTGGAGATCGAGGACTTTCAATATGACGAGGACTCGGAGACATATTTCTACCC TTGCCCCTGTGGGGATAACTTTGCCATCACCAAGGAAGATTTGGAAAATGGAGAAGATGTGGCCACGTGT CCTAGCTGCTCACTCATTATAAAAGTGATTTATGACAAAGATCAGTTCATGTGTGGAGAAACAGTCCCAG CACCTTCAACCAACAAGGAGTTAGTTAAATGCTGAAGAGGCTCTCAGGTACCCACATCCTGAACCGTGGG GGCTGAGCCCAGGTGGATGGATCCAGTGCAGAGTTACCAACCTCCTCGATGGGCAGCCTCAGGGGTGTGA TCTTCATCAGCCACTGAACTCAGCATGAAAAAGGGAGCCTATGACATGCCAGCCCTGGATTCCATACTGG GACTGGAAGGATTCCTAATTGTCCGTCTGAATTTAAGGAAGAGCCTTATTATAAACTGTGGTTTTTCCTT CAGTCGGCTGCATCATTTGAACATCTGGAAATTCATTTTCTGAAAATAACATCATCCGCCTCAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_172254 |
Insert Size | 249 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC029910, AAH29910 |
RefSeq Size | 677 bp |
RefSeq ORF | 249 bp |
Locus ID | 105638 |
UniProt ID | Q8K0W9 |
Gene Summary | Essential for the first step in the synthesis of diphthamide, a post-translational modification of histidine which occurs in elongation factor 2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). Both variants 1 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216237 | Dph3 (tGFP-tagged) - Mouse DPH3 homolog (KTI11 S. cerevisiae) (Dph3) transcript variant 1, (10ug) |
CNY 2090.00 |
|
MR216237 | Dph3 (Myc-DDK-tagged) - Mouse DPH3 homolog (KTI11, S. cerevisiae) (Dph3), transcript variant 1 |
CNY 1200.00 |
|
MR216237L3 | Lenti ORF clone of Dph3 (Myc-DDK-tagged) - Mouse DPH3 homolog (KTI11, S. cerevisiae) (Dph3), transcript variant 1 |
CNY 3800.00 |
|
MR216237L4 | Lenti ORF clone of Dph3 (mGFP-tagged) - Mouse DPH3 homolog (KTI11, S. cerevisiae) (Dph3), transcript variant 1 |
CNY 3800.00 |