Phf5a (NM_026737) Mouse Untagged Clone
CAT#: MC202248
Phf5a (untagged) - Mouse PHD finger protein 5A (Phf5a), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110007B08Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025161 sequence for NM_026737
GTTCCCTAAGCTTCCGGCCGCCGGCTTGGAAAAAGAGTTATGGCTAAACATCATCCAGATTTGATTTTCT GCCGCAAGCAGGCTGGTGTGGCTATCGGAAGACTGTGTGAAAAATGTGACGGCAAGTGTGTGATCTGTGA TTCCTACGTGCGTCCCTGCACCCTGGTCCGCATATGTGATGAGTGTAACTATGGATCTTACCAGGGCCGG TGTGTAATCTGTGGCGGCCCCGGAGTCTCCGATGCCTACTACTGTAAAGAGTGCACCATTCAGGAGAAGG ATAGAGATGGTTGTCCAAAGATTGTCAATTTGGGGAGCTCTAAGACAGACCTGTTCTATGAACGCAAAAA ATACGGCTTCAAGAAGAGGTGATGGGTGGGTGGCTCCTTCCTCCCCCATCAAACTGCTGCAGCTGCCAGA ATAGACGCCTACTACCACCGCCTAAAGGGAACGGAGCTGAGTGTCACCAGAGCAGCCTGCTAGTGCTAGT GTCCTGGCCCCTGCCACTAGCAAGTGCCCATGGAGCATCTGGCAGACTGGAGGAGACGTTGCTCGCTTAG TCCCTAGTTCCCTTTTTGTTTTGAGTTGGAAAAGCAAGGCTCTGTTCTCCACATTGATCCTTTCAACTCA AAAGCCTCAAAACAAGTTGGTGTGTGTCCTTGGTGATGAAACTGTCCCGGCAGAAGTGTGGTCTTGCAGC AGCTATGATGGGGTTGTCCTGTGACCCTCAGTGTGGCCAGGTGTGACCTGAACAGTAATGTGACCTGACA ATTTGCAGGTGGTGCTGGGCTCGTGTTATTTTCCTTGTAAGTTGGAAGTTTCAATTACGCTAATAAAGTT GGCTACCTTCCCCGTTAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026737 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC025161, AAH25161 |
RefSeq Size | 872 bp |
RefSeq ORF | 333 bp |
Locus ID | 68479 |
UniProt ID | P83870 |
Gene Summary | Involved with the PAF1 complex (PAF1C) in transcriptional elongation by RNA polymerase II, and in regulation of development and maintenance of embryonic stem cell (ESC) pluripotency. Required for maintenance of ESCs self-renewal and cellular reprogramming of stem cells. Maintains pluripotency by recruiting and stabilizing PAF1C on pluripotency genes loci, and by regulating the expression of the pluripotency genes. Regulates the deposition of elongation-associated histone modifications, including dimethylated histone H3 'Lys-79' (H3K79me2) and trimethylated histone H3 'Lys-36' (H3K36me3), on PAF1C targets, self-renewal and pluripotency genes. Regulates RNA polymerase II promoter-proximal pause release of the PAF1C targets and self-renewal genes, and the levels of elongating ('Ser-2' phosphorylated) RNA polymerase II in their gene bodies. Regulates muscle specification in adult stem cells by stabilizing PAF1C in chromatin to promote myogenic differentiation (PubMed:27749823). Involved in pre-mRNA splicing as a component of the splicing factor SF3B complex. SF3B complex is required for 'A' complex assembly formed by the stable binding of U2 snRNP to the branchpoint sequence (BPS) in pre-mRNA. Sequence independent binding of SF3A/SF3B complex upstream of the branch site is essential, it may anchor U2 snRNP to the pre-mRNA (By similarity). Acts as a transcriptional regulator by binding to the GJA1/Cx43 promoter and enhancing its up-regulation by ESR1/ER-alpha (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200425 | Phf5a (tGFP-tagged) - Mouse PHD finger protein 5A (Phf5a) |
CNY 2850.00 |
|
MR200425 | Phf5a (Myc-DDK-tagged) - Mouse PHD finger protein 5A (Phf5a) |
CNY 1200.00 |
|
MR200425L3 | Lenti ORF clone of Phf5a (Myc-DDK-tagged) - Mouse PHD finger protein 5A (Phf5a) |
CNY 4750.00 |
|
MR200425L4 | Lenti ORF clone of Phf5a (mGFP-tagged) - Mouse PHD finger protein 5A (Phf5a) |
CNY 4750.00 |