Eny2 (NM_175009) Mouse Untagged Clone

CAT#: MC202310

Eny2 (untagged) - Mouse enhancer of yellow 2 homolog (Drosophila) (Eny2), (10ug)



  "NM_175009" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1810057B09Rik; 6720481I12; DC6; Ey2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC048361 sequence for NM_175009
GTAGCTTTCTGTGTGCTTAGGTGCCCGAGCTACTGAGGGTCTAAGTCCGGGCAGCCGAAGAGTGTGGTAG GTAACGGTCGTCAGCGCAAGGGTCATTTCGTCGCTGGGAAGGGACGGCCCTCGCCCGCGGTGATGGTGGT TAGCAAGATGAACAAAGATGCGCAGATGAGAGCAGCGATTAACCAAAAGTTAATAGAAACTGGAGAAAGA GAACGCCTCAAAGAGTTGCTGAGAGCTAAATTAATTGAGTGCGGCTGGAAGGATCAGCTAAAGGCACACT GTAAAGAGGTAATTAAAGAAAAAGGACTAGAACACGTTACTGTTGATGACTTGGTGGCTGAAATCACTCC AAAAGGCAGAGCCCTGGTACCTGACAGTGTAAAGAAGGAGCTCCTACAGAGAATAAGAACATTCCTTGCT CAGCATGCCAGTCTTTAAGGGTGAATTAGAATGTGTTGGTCTGTGGATTTATTTCTGAAAGTAAAACTTG CCATAATTAGAAATTGATTTCCCAAATAAAGTCCTTTTTTGTATGATGGTATACAGTTTTCAGTAATGTA TACATTGTATTGATTTTTTCCCTAAATGTGTTATTTTAATAAATATCTCATGAATGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_175009
Insert Size 306 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC048361, AAH48361
RefSeq Size 647 bp
RefSeq ORF 306 bp
Locus ID 223527
UniProt ID Q9JIX0
Gene Summary Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates in a subcomplex that specifically deubiquitinates both histones H2A and H2B. The SAGA complex is recruited to specific gene promoters by activators such as MYC, where it is required for transcription. Required for nuclear receptor-mediated transactivation. As a component of the TREX-2 complex, involved in the export of mRNAs to the cytoplasm through the nuclear pores (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...