Nrtn (NM_008738) Mouse Untagged Clone
CAT#: MC202337
Nrtn (untagged) - Mouse neurturin (Nrtn), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | NTN |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC057993 sequence for NM_008738
GCTTCGTCCGTGTGCCCCGCGCCCGGCGCTCCTCGCGTGGCCCCGCGTCCTGAGCGCGCTCCAGCCTCCC ACGCGCGCCACCCCGGGGTTCACTGAGCCCGGCGAGCCCGGGGAAGACAGAGAAAGAGAGGCCAGGGGGG GAACCCCATGGCCCGGCCCGTGTCCCGCACCCTGTGCGGTGGCCTCCTCCGGCACGGGGTCCCCGGGTCG CCTCCGGTCCCCGCGATCCGGATGGCGCACGCAGTGGCTGGGGCCGGGCCGGGCTCGGGTGGTCGGAGGA GTCACCACTGACCGGGTCATCTGGAGCCCGTGGCAGGCCGAGGCCCAGGATGAGGCGCTGGAAGGCAGCG GCCCTGGTGTCGCTCATCTGCAGCTCCCTGCTATCTGTCTGGATGTGCCAGGAGGGTCTGCTCTTGGGCC ACCGCCTGGGACCCGCGCTTGCCCCGCTACGACGCCCTCCACGCACCCTGGACGCCCGCATCGCCCGCCT GGCCCAGTATCGCGCTCTGCTCCAGGGCGCCCCCGACGCGGTGGAGCTTCGAGAACTTTCTCCCTGGGCT GCCCGCATCCCGGGACCGCGCCGTCGAGCGGGTCCCCGGCGTCGGCGGGCGCGGCCGGGGGCTCGGCCTT GTGGGCTGCGCGAGCTCGAGGTGCGCGTGAGCGAGCTGGGCCTGGGCTACACGTCGGATGAGACCGTGCT GTTCCGCTACTGCGCAGGCGCGTGCGAGGCGGCCATCCGCATCTACGACCTGGGCCTTCGGCGCCTGCGC CAGCGGAGGCGCGTGCGCAGAGAGCGGGCGCGGGCGCACCCGTGTTGTCGCCCGACGGCCTATGAGGACG AGGTGTCCTTCCTGGACGTGCACAGCCGCTACCACACGCTGCAAGAGCTGTCGGCGCGGGAGTGCGCGTG CGTGTGATGCTACCTCACGCCCCCCGACCTGCGAAAGGGCCCTCCCTGCCGACCCTCGCTGAGAACTGAC TTCACATAAAGTGTGGGAACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008738 |
| Insert Size | 588 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC057993, AAH57993 |
| RefSeq Size | 1064 bp |
| RefSeq ORF | 588 bp |
| Locus ID | 18188 |
| UniProt ID | P97463 |
| Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. Homozygous knockout mice for this gene exhibit defects in the development of the retina and enteric nervous system, and reduced cholinergic innervation of the heart and lacrimal glands. [provided by RefSeq, Aug 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201908 | Nrtn (tGFP-tagged) - Mouse neurturin (Nrtn) |
CNY 2850.00 |
|
| MR201908 | Nrtn (Myc-DDK-tagged) - Mouse neurturin (Nrtn) |
CNY 2400.00 |
|
| MR201908L3 | Lenti ORF clone of Nrtn (Myc-DDK-tagged) - Mouse neurturin (Nrtn) |
CNY 4750.00 |
|
| MR201908L4 | Lenti ORF clone of Nrtn (mGFP-tagged) - Mouse neurturin (Nrtn) |
CNY 4750.00 |
